Incidental Mutation 'R6945:L1td1'
ID540832
Institutional Source Beutler Lab
Gene Symbol L1td1
Ensembl Gene ENSMUSG00000087166
Gene NameLINE-1 type transposase domain containing 1
SynonymsECAT11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R6945 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location98726734-98738480 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98733696 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 165 (V165A)
Ref Sequence ENSEMBL: ENSMUSP00000127504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000152889] [ENSMUST00000154279] [ENSMUST00000171708] [ENSMUST00000173659]
Predicted Effect probably benign
Transcript: ENSMUST00000152889
Predicted Effect probably benign
Transcript: ENSMUST00000154279
AA Change: V165A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127504
Gene: ENSMUSG00000087166
AA Change: V165A

DomainStartEndE-ValueType
Pfam:Transposase_22 175 295 4e-21 PFAM
low complexity region 346 397 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
Pfam:Transposase_22 495 782 2.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171708
Predicted Effect unknown
Transcript: ENSMUST00000173659
AA Change: V165A
SMART Domains Protein: ENSMUSP00000134149
Gene: ENSMUSG00000087166
AA Change: V165A

DomainStartEndE-ValueType
Pfam:Transposase_22 175 291 6e-20 PFAM
coiled coil region 383 431 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Pfam:Transposase_22 568 848 4.3e-57 PFAM
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal development and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,676,845 N246K probably benign Het
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Acaa2 A G 18: 74,793,309 E112G probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cacnb4 T C 2: 52,474,954 N99S probably damaging Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Furin A G 7: 80,391,090 S667P possibly damaging Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Hyal1 C A 9: 107,579,170 A102E probably damaging Het
Invs T C 4: 48,421,785 C806R probably benign Het
Lama1 A G 17: 67,813,866 T2666A Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc8a A G 2: 30,256,227 Y351C probably damaging Het
Myh7b T C 2: 155,622,232 F551S possibly damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr1040 A G 2: 86,146,084 S217P probably damaging Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psat1 T A 19: 15,917,181 T115S probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Syna A G 5: 134,558,961 V378A probably damaging Het
Tchp A G 5: 114,709,350 K77E possibly damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in L1td1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:L1td1 APN 4 98737344 missense probably damaging 0.99
IGL02529:L1td1 APN 4 98737421 missense probably benign 0.01
R0254:L1td1 UTSW 4 98737182 nonsense probably null
R0924:L1td1 UTSW 4 98737625 missense probably damaging 1.00
R0930:L1td1 UTSW 4 98737625 missense probably damaging 1.00
R1434:L1td1 UTSW 4 98737817 missense possibly damaging 0.91
R1573:L1td1 UTSW 4 98737280 missense probably benign 0.01
R1751:L1td1 UTSW 4 98737449 missense probably benign 0.32
R1767:L1td1 UTSW 4 98737449 missense probably benign 0.32
R1870:L1td1 UTSW 4 98737477 missense possibly damaging 0.93
R2006:L1td1 UTSW 4 98733489 missense possibly damaging 0.53
R2252:L1td1 UTSW 4 98737637 unclassified probably null
R2383:L1td1 UTSW 4 98737722 missense possibly damaging 0.93
R2472:L1td1 UTSW 4 98733159 unclassified probably benign
R3195:L1td1 UTSW 4 98737518 missense possibly damaging 0.47
R3763:L1td1 UTSW 4 98737835 missense probably damaging 0.99
R3950:L1td1 UTSW 4 98737353 missense probably benign 0.12
R3962:L1td1 UTSW 4 98737449 missense probably benign 0.32
R4430:L1td1 UTSW 4 98737151 missense probably benign 0.00
R4643:L1td1 UTSW 4 98737883 missense probably damaging 0.98
R4661:L1td1 UTSW 4 98733624 missense possibly damaging 0.94
R4885:L1td1 UTSW 4 98737311 missense probably benign 0.01
R5345:L1td1 UTSW 4 98736447 missense probably damaging 1.00
R5589:L1td1 UTSW 4 98738104 missense possibly damaging 0.66
R5800:L1td1 UTSW 4 98733762 missense possibly damaging 0.96
R6207:L1td1 UTSW 4 98737418 missense possibly damaging 0.55
R6309:L1td1 UTSW 4 98737091 missense probably damaging 0.99
R6917:L1td1 UTSW 4 98734031 missense probably benign 0.18
R7185:L1td1 UTSW 4 98736618 missense possibly damaging 0.72
R7258:L1td1 UTSW 4 98736864 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GATGCAATCTCGGAAAGGCC -3'
(R):5'- GCACCTATACTCTTCACGACCG -3'

Sequencing Primer
(F):5'- TCTCGGAAAGGCCAAAGC -3'
(R):5'- TGCGGGAACACATCTTTCAG -3'
Posted On2018-11-28