Incidental Mutation 'R6945:Furin'
ID540842
Institutional Source Beutler Lab
Gene Symbol Furin
Ensembl Gene ENSMUSG00000030530
Gene Namefurin (paired basic amino acid cleaving enzyme)
SynonymsPcsk3, PACE, SPC1, 9130404I01Rik, Fur
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6945 (G1)
Quality Score155.008
Status Not validated
Chromosome7
Chromosomal Location80388585-80405436 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80391090 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 667 (S667P)
Ref Sequence ENSEMBL: ENSMUSP00000113370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080932] [ENSMUST00000107362] [ENSMUST00000120753] [ENSMUST00000122232] [ENSMUST00000205617] [ENSMUST00000206479] [ENSMUST00000206539] [ENSMUST00000206698] [ENSMUST00000206728] [ENSMUST00000206744]
Predicted Effect probably benign
Transcript: ENSMUST00000080932
SMART Domains Protein: ENSMUSP00000079733
Gene: ENSMUSG00000053158

DomainStartEndE-ValueType
FCH 1 94 2.22e-26 SMART
coiled coil region 133 165 N/A INTRINSIC
coiled coil region 320 344 N/A INTRINSIC
SH2 458 536 8.41e-26 SMART
TyrKc 561 814 1.57e-144 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107362
AA Change: S667P

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102985
Gene: ENSMUSG00000030530
AA Change: S667P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120753
AA Change: S667P

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113793
Gene: ENSMUSG00000030530
AA Change: S667P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:S8_pro-domain 33 107 5.8e-28 PFAM
Pfam:Peptidase_S8 144 427 9.1e-51 PFAM
Pfam:P_proprotein 484 570 4.4e-32 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122232
AA Change: S667P

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113370
Gene: ENSMUSG00000030530
AA Change: S667P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205617
Predicted Effect probably benign
Transcript: ENSMUST00000206352
Predicted Effect probably benign
Transcript: ENSMUST00000206479
Predicted Effect probably benign
Transcript: ENSMUST00000206539
Predicted Effect probably benign
Transcript: ENSMUST00000206698
Predicted Effect probably benign
Transcript: ENSMUST00000206728
Predicted Effect probably benign
Transcript: ENSMUST00000206744
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: This gene encodes a calcium-dependent serine endoprotease that proteolytically activates different proprotein substrates traversing the secretory pathway. The encoded protein undergoes proteolytic autoactivation during which an N-terminal propeptide is cleaved to generate the mature protein. Mice lacking the encoded protein die at an embryonic stage and display hemodynamic insufficiency, cardiac ventral closure defect, axial rotation defect and abnormal yolk sac vasculature. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null embryos die at E10.5-E11.5. Embryos homozygous for one knock-out allele show multiple tissue abnormalities including abnormal yolk sac vasculature and chorioallantoic fusion, failure of axial rotation, a kinked neural tube, exencephaly and severe ventral closure and cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,676,845 N246K probably benign Het
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Acaa2 A G 18: 74,793,309 E112G probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cacnb4 T C 2: 52,474,954 N99S probably damaging Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Hyal1 C A 9: 107,579,170 A102E probably damaging Het
Invs T C 4: 48,421,785 C806R probably benign Het
L1td1 T C 4: 98,733,696 V165A probably benign Het
Lama1 A G 17: 67,813,866 T2666A Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc8a A G 2: 30,256,227 Y351C probably damaging Het
Myh7b T C 2: 155,622,232 F551S possibly damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr1040 A G 2: 86,146,084 S217P probably damaging Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psat1 T A 19: 15,917,181 T115S probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Syna A G 5: 134,558,961 V378A probably damaging Het
Tchp A G 5: 114,709,350 K77E possibly damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Furin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Furin APN 7 80392567 missense probably damaging 1.00
IGL00910:Furin APN 7 80390996 missense probably benign
IGL01701:Furin APN 7 80392492 missense probably benign 0.11
IGL01701:Furin APN 7 80390759 missense probably benign 0.00
IGL01921:Furin APN 7 80395954 unclassified probably benign
IGL01981:Furin APN 7 80392899 missense probably damaging 1.00
IGL02035:Furin APN 7 80390987 missense probably benign
IGL02096:Furin APN 7 80393459 missense probably damaging 1.00
IGL02508:Furin APN 7 80392521 missense probably benign 0.01
IGL02611:Furin APN 7 80391778 missense probably benign 0.04
R0359:Furin UTSW 7 80391284 missense probably damaging 1.00
R0481:Furin UTSW 7 80393549 missense probably damaging 1.00
R0554:Furin UTSW 7 80391284 missense probably damaging 1.00
R1346:Furin UTSW 7 80392184 unclassified probably benign
R1347:Furin UTSW 7 80392184 unclassified probably benign
R1373:Furin UTSW 7 80392184 unclassified probably benign
R1553:Furin UTSW 7 80398592 unclassified probably null
R1693:Furin UTSW 7 80392482 missense probably damaging 1.00
R4524:Furin UTSW 7 80398634 unclassified probably null
R4687:Furin UTSW 7 80393447 missense probably benign 0.00
R4869:Furin UTSW 7 80396979 missense probably damaging 1.00
R5249:Furin UTSW 7 80393421 missense probably damaging 1.00
R5498:Furin UTSW 7 80391794 missense probably damaging 1.00
R5708:Furin UTSW 7 80397855 intron probably benign
R6086:Furin UTSW 7 80395431 missense probably damaging 1.00
R6505:Furin UTSW 7 80393617 missense probably damaging 1.00
R6772:Furin UTSW 7 80393492 missense probably damaging 1.00
R6954:Furin UTSW 7 80396964 missense possibly damaging 0.79
X0050:Furin UTSW 7 80395412 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACACTTTCACTCCCCGGAAG -3'
(R):5'- ACCAGAAAAGCTGTGTCCAG -3'

Sequencing Primer
(F):5'- TTTCACTCCCCGGAAGCTGAAG -3'
(R):5'- TGTCCAGCACTGCCCAC -3'
Posted On2018-11-28