Incidental Mutation 'R6945:Lama1'
ID540865
Institutional Source Beutler Lab
Gene Symbol Lama1
Ensembl Gene ENSMUSG00000032796
Gene Namelaminin, alpha 1
SynonymsLama
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6945 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location67697265-67822645 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67813866 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2666 (T2666A)
Ref Sequence ENSEMBL: ENSMUSP00000043957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035471]
Predicted Effect
SMART Domains Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: T2666A

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
LamNT 23 275 1.2e-131 SMART
EGF_Lam 277 331 1e-5 SMART
EGF_Lam 334 401 6.6e-6 SMART
EGF_Lam 404 458 9.11e-9 SMART
EGF_Lam 461 507 8.12e-6 SMART
LamB 570 702 2.09e-57 SMART
EGF_like 715 746 3.36e0 SMART
EGF_Lam 749 795 7.01e-10 SMART
EGF_Lam 798 853 3.59e-7 SMART
EGF_Lam 856 906 1.53e-10 SMART
EGF_Lam 909 955 1.13e-13 SMART
EGF_Lam 958 1002 1.36e-7 SMART
EGF_Lam 1005 1048 7.29e-8 SMART
EGF_like 1034 1082 4.83e1 SMART
EGF_Lam 1051 1094 1.67e-7 SMART
EGF_Lam 1097 1154 1.32e-5 SMART
LamB 1220 1352 8.7e-46 SMART
Pfam:Laminin_EGF 1367 1397 1.7e-6 PFAM
EGF_Lam 1410 1456 7.12e-11 SMART
EGF_Lam 1459 1513 3.25e-5 SMART
EGF_like 1497 1547 6.41e1 SMART
EGF_Lam 1516 1560 1.71e-13 SMART
Pfam:Laminin_I 1574 1838 1.7e-91 PFAM
low complexity region 2012 2031 N/A INTRINSIC
low complexity region 2087 2098 N/A INTRINSIC
LamG 2145 2287 3.66e-30 SMART
LamG 2332 2473 5.98e-35 SMART
LamG 2513 2661 1.11e-29 SMART
low complexity region 2695 2708 N/A INTRINSIC
LamG 2743 2877 9.72e-35 SMART
LamG 2920 3056 4.63e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,676,845 N246K probably benign Het
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Acaa2 A G 18: 74,793,309 E112G probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cacnb4 T C 2: 52,474,954 N99S probably damaging Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Furin A G 7: 80,391,090 S667P possibly damaging Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Hyal1 C A 9: 107,579,170 A102E probably damaging Het
Invs T C 4: 48,421,785 C806R probably benign Het
L1td1 T C 4: 98,733,696 V165A probably benign Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc8a A G 2: 30,256,227 Y351C probably damaging Het
Myh7b T C 2: 155,622,232 F551S possibly damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr1040 A G 2: 86,146,084 S217P probably damaging Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psat1 T A 19: 15,917,181 T115S probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Syna A G 5: 134,558,961 V378A probably damaging Het
Tchp A G 5: 114,709,350 K77E possibly damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Lama1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Lama1 APN 17 67815928 missense probably benign
IGL00336:Lama1 APN 17 67813948 missense probably benign 0.07
IGL01066:Lama1 APN 17 67743326 missense probably damaging 1.00
IGL01140:Lama1 APN 17 67802933 missense probably benign 0.14
IGL01291:Lama1 APN 17 67738870 missense probably damaging 1.00
IGL01296:Lama1 APN 17 67745051 missense probably benign 0.27
IGL01317:Lama1 APN 17 67818701 missense probably damaging 1.00
IGL01490:Lama1 APN 17 67750584 missense possibly damaging 0.54
IGL01506:Lama1 APN 17 67785070 missense probably benign 0.01
IGL01508:Lama1 APN 17 67809361 splice site probably benign
IGL01522:Lama1 APN 17 67752774 splice site probably benign
IGL01530:Lama1 APN 17 67796790 missense probably benign 0.02
IGL01541:Lama1 APN 17 67785070 missense probably benign 0.01
IGL01677:Lama1 APN 17 67779148 missense probably benign 0.15
IGL01886:Lama1 APN 17 67807797 missense probably benign 0.36
IGL01994:Lama1 APN 17 67752439 missense probably benign 0.05
IGL02017:Lama1 APN 17 67764725 missense probably benign 0.00
IGL02021:Lama1 APN 17 67821626 missense probably damaging 1.00
IGL02026:Lama1 APN 17 67809292 missense possibly damaging 0.82
IGL02044:Lama1 APN 17 67811490 missense probably benign 0.01
IGL02120:Lama1 APN 17 67716789 missense probably damaging 1.00
IGL02425:Lama1 APN 17 67811485 missense probably benign 0.45
IGL02549:Lama1 APN 17 67790835 missense possibly damaging 0.93
IGL02642:Lama1 APN 17 67812366 missense probably benign 0.00
IGL02795:Lama1 APN 17 67738894 splice site probably null
IGL02798:Lama1 APN 17 67795191 splice site probably benign
IGL02863:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02870:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02876:Lama1 APN 17 67750692 critical splice donor site probably null
IGL02885:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02891:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02978:Lama1 APN 17 67786081 nonsense probably null
IGL03064:Lama1 APN 17 67779104 missense probably benign 0.01
IGL03076:Lama1 APN 17 67716799 missense possibly damaging 0.95
IGL03110:Lama1 APN 17 67798986 missense probably benign 0.04
IGL03143:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL03159:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL03268:Lama1 APN 17 67804536 missense probably damaging 0.99
ANU05:Lama1 UTSW 17 67738870 missense probably damaging 1.00
PIT4472001:Lama1 UTSW 17 67764704 missense
R0047:Lama1 UTSW 17 67795186 splice site probably benign
R0047:Lama1 UTSW 17 67795186 splice site probably benign
R0050:Lama1 UTSW 17 67782056 missense possibly damaging 0.66
R0096:Lama1 UTSW 17 67805413 missense probably benign 0.12
R0096:Lama1 UTSW 17 67805413 missense probably benign 0.12
R0111:Lama1 UTSW 17 67737498 missense probably damaging 0.98
R0116:Lama1 UTSW 17 67776923 missense probably benign 0.10
R0121:Lama1 UTSW 17 67798513 splice site probably benign
R0278:Lama1 UTSW 17 67810183 missense probably null 0.98
R0281:Lama1 UTSW 17 67817569 missense probably damaging 1.00
R0312:Lama1 UTSW 17 67775851 missense possibly damaging 0.45
R0419:Lama1 UTSW 17 67791610 critical splice donor site probably null
R0512:Lama1 UTSW 17 67779134 missense possibly damaging 0.67
R0514:Lama1 UTSW 17 67764698 missense probably benign 0.40
R0562:Lama1 UTSW 17 67815959 missense probably damaging 1.00
R0632:Lama1 UTSW 17 67752368 splice site probably benign
R0645:Lama1 UTSW 17 67773712 missense probably benign 0.01
R0712:Lama1 UTSW 17 67779042 splice site probably null
R0763:Lama1 UTSW 17 67772818 missense probably damaging 0.97
R0941:Lama1 UTSW 17 67775865 missense probably benign 0.10
R1025:Lama1 UTSW 17 67752898 missense probably benign 0.00
R1084:Lama1 UTSW 17 67804469 missense probably benign 0.12
R1103:Lama1 UTSW 17 67790947 missense probably damaging 0.98
R1420:Lama1 UTSW 17 67790947 missense probably damaging 0.98
R1430:Lama1 UTSW 17 67782155 missense possibly damaging 0.95
R1569:Lama1 UTSW 17 67780618 splice site probably null
R1575:Lama1 UTSW 17 67810409 missense possibly damaging 0.96
R1613:Lama1 UTSW 17 67807923 missense probably benign 0.42
R1620:Lama1 UTSW 17 67767033 missense probably benign 0.01
R1629:Lama1 UTSW 17 67805428 missense probably benign 0.00
R1645:Lama1 UTSW 17 67737682 missense probably benign 0.14
R1652:Lama1 UTSW 17 67807846 missense probably damaging 0.97
R1674:Lama1 UTSW 17 67791244 missense probably benign
R1678:Lama1 UTSW 17 67810155 missense possibly damaging 0.56
R1710:Lama1 UTSW 17 67753791 missense probably benign 0.00
R1712:Lama1 UTSW 17 67717186 missense possibly damaging 0.95
R1737:Lama1 UTSW 17 67802921 missense probably benign 0.36
R1757:Lama1 UTSW 17 67763836 missense probably benign 0.40
R1757:Lama1 UTSW 17 67697383 missense unknown
R1813:Lama1 UTSW 17 67791223 missense probably benign
R1896:Lama1 UTSW 17 67791223 missense probably benign
R1945:Lama1 UTSW 17 67745853 missense probably benign 0.14
R2086:Lama1 UTSW 17 67817623 missense probably damaging 1.00
R2149:Lama1 UTSW 17 67773865 missense possibly damaging 0.95
R2178:Lama1 UTSW 17 67769515 missense probably benign 0.07
R2183:Lama1 UTSW 17 67791009 missense probably damaging 0.98
R2197:Lama1 UTSW 17 67752941 missense probably benign 0.02
R2213:Lama1 UTSW 17 67777034 nonsense probably null
R2260:Lama1 UTSW 17 67737507 missense probably damaging 0.96
R2356:Lama1 UTSW 17 67810114 missense probably damaging 1.00
R2420:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2421:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2422:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2424:Lama1 UTSW 17 67798665 missense probably benign 0.09
R2442:Lama1 UTSW 17 67768317 missense probably benign 0.04
R3147:Lama1 UTSW 17 67737658 missense probably damaging 0.98
R3414:Lama1 UTSW 17 67737603 missense probably damaging 1.00
R3683:Lama1 UTSW 17 67768333 missense probably benign 0.40
R3820:Lama1 UTSW 17 67779046 splice site probably null
R3821:Lama1 UTSW 17 67779046 splice site probably null
R3822:Lama1 UTSW 17 67779046 splice site probably null
R4012:Lama1 UTSW 17 67812373 nonsense probably null
R4113:Lama1 UTSW 17 67764703 missense probably benign 0.01
R4133:Lama1 UTSW 17 67750655 missense probably damaging 0.98
R4133:Lama1 UTSW 17 67812486 missense probably damaging 1.00
R4259:Lama1 UTSW 17 67752418 missense possibly damaging 0.95
R4278:Lama1 UTSW 17 67791517 missense probably null 0.00
R4321:Lama1 UTSW 17 67771083 missense probably benign 0.03
R4374:Lama1 UTSW 17 67804518 missense probably benign 0.00
R4386:Lama1 UTSW 17 67773712 missense probably benign 0.01
R4463:Lama1 UTSW 17 67761700 missense probably damaging 1.00
R4629:Lama1 UTSW 17 67805360 critical splice acceptor site probably null
R4630:Lama1 UTSW 17 67794300 missense probably benign 0.00
R4633:Lama1 UTSW 17 67798584 missense probably damaging 0.96
R4668:Lama1 UTSW 17 67752434 missense probably benign 0.27
R4684:Lama1 UTSW 17 67773778 missense possibly damaging 0.88
R4745:Lama1 UTSW 17 67738780 missense probably damaging 1.00
R4786:Lama1 UTSW 17 67773859 missense possibly damaging 0.77
R4797:Lama1 UTSW 17 67716775 missense probably benign 0.04
R4803:Lama1 UTSW 17 67809271 missense probably damaging 1.00
R4925:Lama1 UTSW 17 67794314 missense probably benign 0.02
R4939:Lama1 UTSW 17 67737475 missense possibly damaging 0.91
R4952:Lama1 UTSW 17 67767566 critical splice donor site probably null
R4975:Lama1 UTSW 17 67738834 missense possibly damaging 0.95
R4977:Lama1 UTSW 17 67737682 missense probably damaging 1.00
R5039:Lama1 UTSW 17 67745893 missense possibly damaging 0.66
R5047:Lama1 UTSW 17 67743281 nonsense probably null
R5195:Lama1 UTSW 17 67764800 missense probably benign 0.13
R5230:Lama1 UTSW 17 67745083 nonsense probably null
R5236:Lama1 UTSW 17 67804492 missense probably benign 0.24
R5254:Lama1 UTSW 17 67756716 missense probably benign 0.01
R5345:Lama1 UTSW 17 67817563 missense probably benign
R5438:Lama1 UTSW 17 67800774 missense possibly damaging 0.92
R5521:Lama1 UTSW 17 67780894 nonsense probably null
R5568:Lama1 UTSW 17 67768298 critical splice acceptor site probably null
R5645:Lama1 UTSW 17 67802948 missense probably damaging 1.00
R5665:Lama1 UTSW 17 67770987 missense probably damaging 1.00
R5727:Lama1 UTSW 17 67815224 missense possibly damaging 0.81
R5757:Lama1 UTSW 17 67738787 missense possibly damaging 0.59
R5795:Lama1 UTSW 17 67796727 missense probably benign 0.02
R5857:Lama1 UTSW 17 67807843 missense probably damaging 0.99
R5894:Lama1 UTSW 17 67779047 critical splice acceptor site probably null
R5974:Lama1 UTSW 17 67773727 missense probably benign 0.31
R6032:Lama1 UTSW 17 67750643 missense probably benign 0.01
R6032:Lama1 UTSW 17 67750643 missense probably benign 0.01
R6120:Lama1 UTSW 17 67780617 critical splice donor site probably null
R6219:Lama1 UTSW 17 67790856 missense probably benign 0.08
R6224:Lama1 UTSW 17 67802987 missense possibly damaging 0.56
R6249:Lama1 UTSW 17 67798604 missense probably benign
R6265:Lama1 UTSW 17 67750655 missense probably damaging 0.98
R6276:Lama1 UTSW 17 67784088 splice site probably null
R6284:Lama1 UTSW 17 67810096 missense probably damaging 0.99
R6337:Lama1 UTSW 17 67786019 missense probably benign 0.27
R6414:Lama1 UTSW 17 67746910 critical splice donor site probably null
R6631:Lama1 UTSW 17 67774482 missense probably benign 0.21
R6659:Lama1 UTSW 17 67818635 missense probably damaging 1.00
R6660:Lama1 UTSW 17 67804500 missense probably benign 0.05
R6677:Lama1 UTSW 17 67795233 missense probably benign 0.14
R6763:Lama1 UTSW 17 67746873 missense unknown
R6787:Lama1 UTSW 17 67784025 missense unknown
R6831:Lama1 UTSW 17 67756754 missense possibly damaging 0.89
R6855:Lama1 UTSW 17 67782155 missense possibly damaging 0.95
R6910:Lama1 UTSW 17 67791464 missense possibly damaging 0.60
R6934:Lama1 UTSW 17 67774543 missense probably benign 0.04
R6984:Lama1 UTSW 17 67779112 missense
R6989:Lama1 UTSW 17 67753758 missense
R6994:Lama1 UTSW 17 67753825 missense
R6995:Lama1 UTSW 17 67753825 missense
R7035:Lama1 UTSW 17 67781049 missense
R7133:Lama1 UTSW 17 67782146 missense
R7172:Lama1 UTSW 17 67804545 missense
R7197:Lama1 UTSW 17 67737705 nonsense probably null
R7217:Lama1 UTSW 17 67764673 missense
R7229:Lama1 UTSW 17 67752446 missense
R7264:Lama1 UTSW 17 67743297 missense
R7311:Lama1 UTSW 17 67767385 missense
R7394:Lama1 UTSW 17 67717261 missense
V8831:Lama1 UTSW 17 67752883 missense probably benign 0.00
X0024:Lama1 UTSW 17 67738888 missense probably damaging 1.00
X0028:Lama1 UTSW 17 67767422 missense probably benign 0.00
X0028:Lama1 UTSW 17 67794310 missense probably benign 0.06
X0066:Lama1 UTSW 17 67811566 missense probably damaging 1.00
Z1088:Lama1 UTSW 17 67752883 missense probably benign 0.00
Z1088:Lama1 UTSW 17 67771082 missense probably benign 0.25
Z1088:Lama1 UTSW 17 67810171 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAAAGAGTGGTGTGCCC -3'
(R):5'- TCTCGGAATCTGTCTGCCTG -3'

Sequencing Primer
(F):5'- GGTGTGCCCATGTAACTTGG -3'
(R):5'- GAATCTGTCTGCCTGGGTTCAC -3'
Posted On2018-11-28