Incidental Mutation 'R6945:Psat1'
ID540870
Institutional Source Beutler Lab
Gene Symbol Psat1
Ensembl Gene ENSMUSG00000024640
Gene Namephosphoserine aminotransferase 1
SynonymsD8Ertd814e, PSA, EPIP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6945 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location15904678-15947337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15917181 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 115 (T115S)
Ref Sequence ENSEMBL: ENSMUSP00000125593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025542] [ENSMUST00000162053] [ENSMUST00000162416]
Predicted Effect probably benign
Transcript: ENSMUST00000025542
AA Change: T156S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025542
Gene: ENSMUSG00000024640
AA Change: T156S

DomainStartEndE-ValueType
Pfam:Aminotran_5 7 357 1.3e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162053
AA Change: T153S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125340
Gene: ENSMUSG00000024640
AA Change: T153S

DomainStartEndE-ValueType
Pfam:Aminotran_5 10 354 1.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162416
AA Change: T115S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125593
Gene: ENSMUSG00000024640
AA Change: T115S

DomainStartEndE-ValueType
Pfam:Aminotran_5 1 157 6.5e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-V pyridoxal-phosphate-dependent aminotransferase family. The encoded protein is a phosphoserine aminotransferase and decreased expression may be associated with schizophrenia. Mutations in this gene are also associated with phosphoserine aminotransferase deficiency. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 1, 3, and 8. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit craniofacial defects, exencephaly and growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,676,845 N246K probably benign Het
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Acaa2 A G 18: 74,793,309 E112G probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cacnb4 T C 2: 52,474,954 N99S probably damaging Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Furin A G 7: 80,391,090 S667P possibly damaging Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Hyal1 C A 9: 107,579,170 A102E probably damaging Het
Invs T C 4: 48,421,785 C806R probably benign Het
L1td1 T C 4: 98,733,696 V165A probably benign Het
Lama1 A G 17: 67,813,866 T2666A Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc8a A G 2: 30,256,227 Y351C probably damaging Het
Myh7b T C 2: 155,622,232 F551S possibly damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr1040 A G 2: 86,146,084 S217P probably damaging Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Syna A G 5: 134,558,961 V378A probably damaging Het
Tchp A G 5: 114,709,350 K77E possibly damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Psat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03017:Psat1 APN 19 15917135 missense possibly damaging 0.52
IGL03102:Psat1 APN 19 15906123 missense probably damaging 1.00
R1617:Psat1 UTSW 19 15924302 critical splice donor site probably null
R1758:Psat1 UTSW 19 15914879 missense probably damaging 1.00
R3897:Psat1 UTSW 19 15919453 critical splice donor site probably null
R5138:Psat1 UTSW 19 15914948 missense possibly damaging 0.77
R6899:Psat1 UTSW 19 15918205 critical splice donor site probably null
R6941:Psat1 UTSW 19 15920943 missense probably damaging 1.00
R7268:Psat1 UTSW 19 15917144 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTGTAGTCAAACATGTGCAC -3'
(R):5'- TCATCCCCAGCTGTTAGTGG -3'

Sequencing Primer
(F):5'- TGGTAACAGGCTTCACATCACTGAG -3'
(R):5'- CATCCCCAGCTGTTAGTGGTAATTG -3'
Posted On2018-11-28