Incidental Mutation 'R6946:Ifi44'
ID540879
Institutional Source Beutler Lab
Gene Symbol Ifi44
Ensembl Gene ENSMUSG00000028037
Gene Nameinterferon-induced protein 44
SynonymsA430056A10Rik, p44, MTAP44
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6946 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location151730922-151749960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 151745899 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 190 (I190N)
Ref Sequence ENSEMBL: ENSMUSP00000029671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029671]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029671
AA Change: I190N

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029671
Gene: ENSMUSG00000028037
AA Change: I190N

DomainStartEndE-ValueType
Pfam:TLD 26 147 2.8e-7 PFAM
low complexity region 193 208 N/A INTRINSIC
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Atp8a1 T C 5: 67,622,625 T1142A possibly damaging Het
Atxn1l G T 8: 109,732,016 P538H probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Dap3 T A 3: 88,938,216 probably benign Het
Dgki C A 6: 37,299,636 G105* probably null Het
Dnm3 T C 1: 162,313,655 E345G possibly damaging Het
Fam120a A T 13: 48,881,020 S1039T possibly damaging Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Igll1 A G 16: 16,861,056 V130A probably damaging Het
Ikzf2 T A 1: 69,577,796 K137* probably null Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Lrp1b T C 2: 40,697,439 I166V probably benign Het
Map3k1 C T 13: 111,768,501 W213* probably null Het
Map3k12 A G 15: 102,505,134 M134T possibly damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Nop53 C T 7: 15,938,358 R462Q probably damaging Het
Olfr1085 T A 2: 86,657,588 Y290F probably damaging Het
Olfr502 T A 7: 108,523,321 I210F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Oog2 A T 4: 144,196,464 D433V possibly damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Pcdhb3 T A 18: 37,302,619 L546Q probably damaging Het
Plcg2 A T 8: 117,504,190 M4L probably benign Het
Prss21 T C 17: 23,868,164 S24P possibly damaging Het
Ryr3 T C 2: 112,831,200 D1815G probably damaging Het
Scd4 A G 19: 44,333,514 E8G probably null Het
Sec31b T C 19: 44,534,316 D79G probably damaging Het
Siah1a G T 8: 86,725,142 A238E probably damaging Het
Spag17 G A 3: 100,004,683 E290K possibly damaging Het
Srl T C 16: 4,482,559 I883V probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Ttn A T 2: 76,749,855 W23565R probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Zfp112 A T 7: 24,125,341 N245Y probably damaging Het
Other mutations in Ifi44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Ifi44 APN 3 151749580 missense probably benign 0.03
IGL01477:Ifi44 APN 3 151745998 splice site probably benign
IGL01571:Ifi44 APN 3 151745537 missense probably damaging 0.97
IGL02165:Ifi44 APN 3 151749430 missense probably damaging 1.00
IGL02238:Ifi44 APN 3 151732382 makesense probably null
IGL02609:Ifi44 APN 3 151732497 missense probably damaging 1.00
IGL02650:Ifi44 APN 3 151745855 missense probably damaging 1.00
IGL02726:Ifi44 APN 3 151749596 start gained probably benign
IGL02977:Ifi44 APN 3 151739379 missense probably benign 0.00
R0201:Ifi44 UTSW 3 151745636 missense probably damaging 1.00
R0454:Ifi44 UTSW 3 151745497 missense possibly damaging 0.78
R0763:Ifi44 UTSW 3 151749498 missense probably damaging 1.00
R1640:Ifi44 UTSW 3 151732534 missense probably benign 0.00
R1747:Ifi44 UTSW 3 151749285 missense probably benign 0.00
R2278:Ifi44 UTSW 3 151732388 missense probably benign
R3816:Ifi44 UTSW 3 151749257 missense possibly damaging 0.92
R4075:Ifi44 UTSW 3 151745976 missense probably benign 0.00
R4084:Ifi44 UTSW 3 151745489 critical splice donor site probably null
R4782:Ifi44 UTSW 3 151745592 missense probably damaging 0.99
R5071:Ifi44 UTSW 3 151749632 start gained probably benign
R5074:Ifi44 UTSW 3 151749632 start gained probably benign
R6030:Ifi44 UTSW 3 151749558 missense probably benign 0.00
R6030:Ifi44 UTSW 3 151749558 missense probably benign 0.00
R6128:Ifi44 UTSW 3 151749186 missense probably benign 0.00
R6192:Ifi44 UTSW 3 151745639 critical splice acceptor site probably null
R6434:Ifi44 UTSW 3 151749189 missense probably benign 0.02
R6536:Ifi44 UTSW 3 151732489 missense probably benign 0.03
R6902:Ifi44 UTSW 3 151745899 missense possibly damaging 0.92
R7346:Ifi44 UTSW 3 151732457 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATTGACTGGCCAAATAGTTCC -3'
(R):5'- CTTGTGTGCACGTGGAAGAAG -3'

Sequencing Primer
(F):5'- GTTCCCAATACAGTTAAGTTGAACCG -3'
(R):5'- GCTGCTAATTAGAAACGCTATAGG -3'
Posted On2018-11-28