Incidental Mutation 'R6946:Oog2'
ID540880
Institutional Source Beutler Lab
Gene Symbol Oog2
Ensembl Gene ENSMUSG00000066030
Gene Nameoogenesin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6946 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location144190719-144196934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144196464 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 433 (D433V)
Ref Sequence ENSEMBL: ENSMUSP00000079267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080405] [ENSMUST00000143978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080405
AA Change: D433V

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079267
Gene: ENSMUSG00000066030
AA Change: D433V

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 391 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143978
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Atp8a1 T C 5: 67,622,625 T1142A possibly damaging Het
Atxn1l G T 8: 109,732,016 P538H probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Dap3 T A 3: 88,938,216 probably benign Het
Dgki C A 6: 37,299,636 G105* probably null Het
Dnm3 T C 1: 162,313,655 E345G possibly damaging Het
Evi2 AGTGGTGGTGGTGGTGGTGGTGGTG AGTGGTGGTGGTGGTGGTGGTG 11: 79,516,194 probably benign Het
Fam120a A T 13: 48,881,020 S1039T possibly damaging Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Igll1 A G 16: 16,861,056 V130A probably damaging Het
Ikzf2 T A 1: 69,577,796 K137* probably null Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Lrp1b T C 2: 40,697,439 I166V probably benign Het
Map3k1 C T 13: 111,768,501 W213* probably null Het
Map3k12 A G 15: 102,505,134 M134T possibly damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Olfr1085 T A 2: 86,657,588 Y290F probably damaging Het
Olfr502 T A 7: 108,523,321 I210F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Pcdhb3 T A 18: 37,302,619 L546Q probably damaging Het
Plcg2 A T 8: 117,504,190 M4L probably benign Het
Prss21 T C 17: 23,868,164 S24P possibly damaging Het
Ryr3 T C 2: 112,831,200 D1815G probably damaging Het
Scd4 A G 19: 44,333,514 E8G probably null Het
Sec31b T C 19: 44,534,316 D79G probably damaging Het
Siah1a G T 8: 86,725,142 A238E probably damaging Het
Spag17 G A 3: 100,004,683 E290K possibly damaging Het
Srl T C 16: 4,482,559 I883V probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Ttn A T 2: 76,749,855 W23565R probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Zfp112 A T 7: 24,125,341 N245Y probably damaging Het
Other mutations in Oog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Oog2 APN 4 144195172 missense probably damaging 1.00
IGL01317:Oog2 APN 4 144195267 missense probably benign 0.16
IGL01697:Oog2 APN 4 144195184 missense possibly damaging 0.90
IGL02237:Oog2 APN 4 144196446 missense possibly damaging 0.95
IGL02411:Oog2 APN 4 144195048 missense probably damaging 0.99
IGL02476:Oog2 APN 4 144195229 missense probably benign 0.02
IGL03284:Oog2 APN 4 144196607 unclassified probably benign
IGL03394:Oog2 APN 4 144194006 missense probably benign 0.17
R0538:Oog2 UTSW 4 144196084 nonsense probably null
R0892:Oog2 UTSW 4 144196499 missense probably benign 0.00
R1024:Oog2 UTSW 4 144196286 missense probably damaging 1.00
R4156:Oog2 UTSW 4 144193953 intron probably benign
R4157:Oog2 UTSW 4 144193953 intron probably benign
R4166:Oog2 UTSW 4 144194841 missense probably damaging 1.00
R4167:Oog2 UTSW 4 144196212 missense probably benign 0.18
R4732:Oog2 UTSW 4 144193941 intron probably benign
R4734:Oog2 UTSW 4 144196451 missense probably benign 0.00
R4741:Oog2 UTSW 4 144195145 missense possibly damaging 0.94
R4909:Oog2 UTSW 4 144195099 missense possibly damaging 0.78
R4954:Oog2 UTSW 4 144190732 start gained probably benign
R6437:Oog2 UTSW 4 144195108 unclassified probably null
R6487:Oog2 UTSW 4 144196485 missense possibly damaging 0.48
Predicted Primers
Posted On2018-11-28