Incidental Mutation 'R6947:Mettl25'
ID540931
Institutional Source Beutler Lab
Gene Symbol Mettl25
Ensembl Gene ENSMUSG00000036009
Gene Namemethyltransferase like 25
SynonymsBC067068
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R6947 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location105763189-105841380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105826192 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 306 (F306L)
Ref Sequence ENSEMBL: ENSMUSP00000038665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046638] [ENSMUST00000176040] [ENSMUST00000176924]
Predicted Effect probably benign
Transcript: ENSMUST00000046638
AA Change: F306L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038665
Gene: ENSMUSG00000036009
AA Change: F306L

DomainStartEndE-ValueType
Pfam:Methyltransf_32 149 413 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176040
Predicted Effect probably benign
Transcript: ENSMUST00000176924
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.0%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,191,804 probably null Het
Adcy4 T C 14: 55,778,391 T414A possibly damaging Het
Bop1 A G 15: 76,453,988 F561L probably damaging Het
Ccdc18 T C 5: 108,161,535 V332A probably benign Het
Cep290 A G 10: 100,530,056 T1042A probably damaging Het
Cnot8 G T 11: 58,117,505 V266L probably benign Het
Cxxc4 C T 3: 134,240,516 S286F possibly damaging Het
Cyp2d12 A T 15: 82,559,047 I386L probably benign Het
Dgka A T 10: 128,733,015 I227N probably damaging Het
Eif2d T C 1: 131,164,667 V354A probably benign Het
Fgr T A 4: 132,995,069 probably null Het
Idnk A G 13: 58,160,241 probably null Het
Kmt2e T C 5: 23,497,545 S952P probably damaging Het
Kng1 A G 16: 23,077,374 H343R probably benign Het
Lgals8 G A 13: 12,454,801 probably benign Het
Lrit3 T A 3: 129,789,234 Q368L probably benign Het
Lypd8 A T 11: 58,382,766 T24S probably benign Het
Map3k4 G A 17: 12,260,569 Q704* probably null Het
Mcm3ap A G 10: 76,515,666 I1948V probably benign Het
Mos A C 4: 3,871,585 V77G probably damaging Het
Muc4 C T 16: 32,775,803 R3130C possibly damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nup107 A G 10: 117,757,274 V833A probably benign Het
Olfr1022 T C 2: 85,868,927 F112L probably benign Het
Olfr409-ps1 C T 11: 74,317,544 S173L unknown Het
Pcnx2 C T 8: 125,850,282 probably null Het
Pde10a T A 17: 8,969,592 I908N probably damaging Het
Plcb1 A G 2: 135,386,155 K1058R probably benign Het
Rad17 A T 13: 100,622,875 F548Y probably damaging Het
Rad54b T G 4: 11,569,859 S58R possibly damaging Het
Rbm20 G A 19: 53,851,265 G895D probably damaging Het
Rgs22 T C 15: 36,103,890 probably null Het
Rhobtb3 A G 13: 75,910,666 S338P probably benign Het
Ruvbl2 A G 7: 45,424,949 probably null Het
Slc16a12 A G 19: 34,672,607 F343L probably benign Het
Slc22a28 A G 19: 8,064,510 L444P possibly damaging Het
Slc44a4 A T 17: 34,928,068 Q358L probably null Het
Sowaha A G 11: 53,478,398 F504L probably benign Het
Syne1 A G 10: 5,175,789 L6035P probably damaging Het
Thbs2 A T 17: 14,689,767 M190K possibly damaging Het
Tmem171 A G 13: 98,688,442 F227L possibly damaging Het
Trp53 A G 11: 69,588,481 K162E possibly damaging Het
Ttn T A 2: 76,894,388 K2098* probably null Het
Usp30 T C 5: 114,103,760 S88P probably benign Het
Zfp276 C A 8: 123,254,904 D63E probably benign Het
Other mutations in Mettl25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Mettl25 APN 10 105826434 missense probably benign
IGL00698:Mettl25 APN 10 105793340 missense probably null 0.31
IGL00766:Mettl25 APN 10 105779582 splice site probably benign
IGL01360:Mettl25 APN 10 105823197 missense probably damaging 1.00
IGL01954:Mettl25 APN 10 105823207 missense probably damaging 1.00
IGL02088:Mettl25 APN 10 105823250 missense probably damaging 1.00
IGL02623:Mettl25 APN 10 105826324 missense probably damaging 0.96
IGL03245:Mettl25 APN 10 105826497 missense possibly damaging 0.86
IGL03134:Mettl25 UTSW 10 105826027 nonsense probably null
R0238:Mettl25 UTSW 10 105826525 missense probably damaging 1.00
R0238:Mettl25 UTSW 10 105826525 missense probably damaging 1.00
R0239:Mettl25 UTSW 10 105826525 missense probably damaging 1.00
R0239:Mettl25 UTSW 10 105826525 missense probably damaging 1.00
R1297:Mettl25 UTSW 10 105823265 missense probably benign 0.11
R1482:Mettl25 UTSW 10 105826590 missense possibly damaging 0.61
R1526:Mettl25 UTSW 10 105832983 missense possibly damaging 0.56
R1542:Mettl25 UTSW 10 105826120 missense probably benign 0.04
R1589:Mettl25 UTSW 10 105779632 missense probably damaging 1.00
R1901:Mettl25 UTSW 10 105826087 missense probably damaging 0.96
R1902:Mettl25 UTSW 10 105826087 missense probably damaging 0.96
R2016:Mettl25 UTSW 10 105797306 missense probably benign 0.00
R2355:Mettl25 UTSW 10 105763455 missense probably benign 0.00
R2920:Mettl25 UTSW 10 105765177 intron probably null
R3149:Mettl25 UTSW 10 105826353 missense probably benign 0.00
R4547:Mettl25 UTSW 10 105826017 missense probably damaging 1.00
R4646:Mettl25 UTSW 10 105826555 missense probably damaging 1.00
R4652:Mettl25 UTSW 10 105779648 nonsense probably null
R5020:Mettl25 UTSW 10 105826207 missense possibly damaging 0.87
R5435:Mettl25 UTSW 10 105779586 critical splice donor site probably null
R7075:Mettl25 UTSW 10 105829924 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CCTCCAGATCTTCAATAATGTCATGC -3'
(R):5'- GCCCAGAGAGTTGAAAGTGC -3'

Sequencing Primer
(F):5'- GTCATGCAATTGTGAATCAGCAGTG -3'
(R):5'- CCCAGAGAGTTGAAAGTGCCAAAG -3'
Posted On2018-11-28