Incidental Mutation 'R6947:Slc44a4'
ID540952
Institutional Source Beutler Lab
Gene Symbol Slc44a4
Ensembl Gene ENSMUSG00000007034
Gene Namesolute carrier family 44, member 4
Synonyms2210409B01Rik, NG22
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R6947 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34914466-34930436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34928068 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 358 (Q358L)
Ref Sequence ENSEMBL: ENSMUSP00000132965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007249] [ENSMUST00000007253] [ENSMUST00000169230]
Predicted Effect probably null
Transcript: ENSMUST00000007249
AA Change: Q510L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007249
Gene: ENSMUSG00000007034
AA Change: Q510L

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Pfam:Choline_transpo 311 674 5.4e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000007253
SMART Domains Protein: ENSMUSP00000007253
Gene: ENSMUSG00000007038

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:BNR_3 74 249 1e-16 PFAM
Pfam:BNR_2 82 377 1.8e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169230
AA Change: Q358L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132965
Gene: ENSMUSG00000007034
AA Change: Q358L

DomainStartEndE-ValueType
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
Pfam:Choline_transpo 157 524 3.9e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be a sodium-dependent transmembrane transport protein involved in the uptake of choline by cholinergic neurons. Defects in this gene can cause sialidosis, a lysosomal storage disease. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,191,804 probably null Het
Adcy4 T C 14: 55,778,391 T414A possibly damaging Het
Bop1 A G 15: 76,453,988 F561L probably damaging Het
Ccdc18 T C 5: 108,161,535 V332A probably benign Het
Cep290 A G 10: 100,530,056 T1042A probably damaging Het
Cnot8 G T 11: 58,117,505 V266L probably benign Het
Cxxc4 C T 3: 134,240,516 S286F possibly damaging Het
Cyp2d12 A T 15: 82,559,047 I386L probably benign Het
Dgka A T 10: 128,733,015 I227N probably damaging Het
Eif2d T C 1: 131,164,667 V354A probably benign Het
Fgr T A 4: 132,995,069 probably null Het
Idnk A G 13: 58,160,241 probably null Het
Kmt2e T C 5: 23,497,545 S952P probably damaging Het
Kng1 A G 16: 23,077,374 H343R probably benign Het
Lgals8 G A 13: 12,454,801 probably benign Het
Lrit3 T A 3: 129,789,234 Q368L probably benign Het
Lypd8 A T 11: 58,382,766 T24S probably benign Het
Map3k4 G A 17: 12,260,569 Q704* probably null Het
Mcm3ap A G 10: 76,515,666 I1948V probably benign Het
Mettl25 A G 10: 105,826,192 F306L probably benign Het
Mos A C 4: 3,871,585 V77G probably damaging Het
Muc4 C T 16: 32,775,803 R3130C possibly damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nup107 A G 10: 117,757,274 V833A probably benign Het
Olfr1022 T C 2: 85,868,927 F112L probably benign Het
Olfr409-ps1 C T 11: 74,317,544 S173L unknown Het
Pcnx2 C T 8: 125,850,282 probably null Het
Pde10a T A 17: 8,969,592 I908N probably damaging Het
Plcb1 A G 2: 135,386,155 K1058R probably benign Het
Rad17 A T 13: 100,622,875 F548Y probably damaging Het
Rad54b T G 4: 11,569,859 S58R possibly damaging Het
Rbm20 G A 19: 53,851,265 G895D probably damaging Het
Rgs22 T C 15: 36,103,890 probably null Het
Rhobtb3 A G 13: 75,910,666 S338P probably benign Het
Ruvbl2 A G 7: 45,424,949 probably null Het
Slc16a12 A G 19: 34,672,607 F343L probably benign Het
Slc22a28 A G 19: 8,064,510 L444P possibly damaging Het
Sowaha A G 11: 53,478,398 F504L probably benign Het
Syne1 A G 10: 5,175,789 L6035P probably damaging Het
Thbs2 A T 17: 14,689,767 M190K possibly damaging Het
Tmem171 A G 13: 98,688,442 F227L possibly damaging Het
Trp53 A G 11: 69,588,481 K162E possibly damaging Het
Ttn T A 2: 76,894,388 K2098* probably null Het
Usp30 T C 5: 114,103,760 S88P probably benign Het
Zfp276 C A 8: 123,254,904 D63E probably benign Het
Other mutations in Slc44a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Slc44a4 APN 17 34930240 utr 3 prime probably benign
IGL01097:Slc44a4 APN 17 34921569 missense probably damaging 0.97
IGL01296:Slc44a4 APN 17 34921698 missense probably benign 0.39
IGL01606:Slc44a4 APN 17 34929018 missense probably damaging 1.00
IGL01759:Slc44a4 APN 17 34921243 missense probably benign 0.00
IGL02026:Slc44a4 APN 17 34921856 splice site probably benign
IGL02119:Slc44a4 APN 17 34928661 missense probably damaging 1.00
IGL02338:Slc44a4 APN 17 34923810 missense possibly damaging 0.90
IGL02383:Slc44a4 APN 17 34927710 missense probably benign 0.00
IGL02526:Slc44a4 APN 17 34928487 missense probably damaging 0.99
IGL02744:Slc44a4 APN 17 34927800 missense probably damaging 1.00
IGL02754:Slc44a4 APN 17 34921303 missense probably damaging 0.98
ANU74:Slc44a4 UTSW 17 34921578 missense probably damaging 1.00
PIT4142001:Slc44a4 UTSW 17 34921275 missense probably damaging 0.99
R0007:Slc44a4 UTSW 17 34921254 missense probably damaging 0.99
R0007:Slc44a4 UTSW 17 34921254 missense probably damaging 0.99
R0452:Slc44a4 UTSW 17 34928095 missense possibly damaging 0.82
R0894:Slc44a4 UTSW 17 34928490 missense possibly damaging 0.92
R1136:Slc44a4 UTSW 17 34928022 missense probably damaging 1.00
R1224:Slc44a4 UTSW 17 34921868 missense probably benign 0.18
R1779:Slc44a4 UTSW 17 34921925 missense probably damaging 1.00
R2679:Slc44a4 UTSW 17 34923423 splice site probably benign
R3499:Slc44a4 UTSW 17 34921680 missense probably benign 0.02
R3732:Slc44a4 UTSW 17 34921561 synonymous silent
R4084:Slc44a4 UTSW 17 34917347 missense probably damaging 1.00
R4197:Slc44a4 UTSW 17 34918252 missense probably benign 0.12
R4536:Slc44a4 UTSW 17 34923839 missense probably damaging 1.00
R4547:Slc44a4 UTSW 17 34927755 missense probably damaging 1.00
R5093:Slc44a4 UTSW 17 34921243 missense probably benign 0.00
R6005:Slc44a4 UTSW 17 34923454 missense possibly damaging 0.69
R6396:Slc44a4 UTSW 17 34928884 nonsense probably null
R6660:Slc44a4 UTSW 17 34930225 missense probably damaging 0.99
R6860:Slc44a4 UTSW 17 34921068 missense probably damaging 1.00
R6863:Slc44a4 UTSW 17 34923822 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TACTGGGCCTTTCACAAGCC -3'
(R):5'- GCAACACTTGAAGCAGCAG -3'

Sequencing Primer
(F):5'- GCCTTTCACAAGCCTCGAG -3'
(R):5'- CACTTGAAGCAGCAGATGATG -3'
Posted On2018-11-28