Incidental Mutation 'R6947:Slc16a12'
ID540954
Institutional Source Beutler Lab
Gene Symbol Slc16a12
Ensembl Gene ENSMUSG00000009378
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 12
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6947 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34668403-34747289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34672607 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 343 (F343L)
Ref Sequence ENSEMBL: ENSMUSP00000009522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009522]
Predicted Effect probably benign
Transcript: ENSMUST00000009522
AA Change: F343L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000009522
Gene: ENSMUSG00000009378
AA Change: F343L

DomainStartEndE-ValueType
Pfam:MFS_1 25 232 5.6e-23 PFAM
Pfam:MFS_1 253 465 1.5e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane transporter that likely plays a role in monocarboxylic acid transport. A mutation in this gene has been associated with juvenile cataracts with microcornea and renal glucosuria. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 C A 9: 90,191,804 probably null Het
Adcy4 T C 14: 55,778,391 T414A possibly damaging Het
Bop1 A G 15: 76,453,988 F561L probably damaging Het
Ccdc18 T C 5: 108,161,535 V332A probably benign Het
Cep290 A G 10: 100,530,056 T1042A probably damaging Het
Cnot8 G T 11: 58,117,505 V266L probably benign Het
Cxxc4 C T 3: 134,240,516 S286F possibly damaging Het
Cyp2d12 A T 15: 82,559,047 I386L probably benign Het
Dgka A T 10: 128,733,015 I227N probably damaging Het
Eif2d T C 1: 131,164,667 V354A probably benign Het
Fgr T A 4: 132,995,069 probably null Het
Idnk A G 13: 58,160,241 probably null Het
Kmt2e T C 5: 23,497,545 S952P probably damaging Het
Kng1 A G 16: 23,077,374 H343R probably benign Het
Lgals8 G A 13: 12,454,801 probably benign Het
Lrit3 T A 3: 129,789,234 Q368L probably benign Het
Lypd8 A T 11: 58,382,766 T24S probably benign Het
Map3k4 G A 17: 12,260,569 Q704* probably null Het
Mcm3ap A G 10: 76,515,666 I1948V probably benign Het
Mettl25 A G 10: 105,826,192 F306L probably benign Het
Mos A C 4: 3,871,585 V77G probably damaging Het
Muc4 C T 16: 32,775,803 R3130C possibly damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nup107 A G 10: 117,757,274 V833A probably benign Het
Olfr1022 T C 2: 85,868,927 F112L probably benign Het
Olfr409-ps1 C T 11: 74,317,544 S173L unknown Het
Pcnx2 C T 8: 125,850,282 probably null Het
Pde10a T A 17: 8,969,592 I908N probably damaging Het
Plcb1 A G 2: 135,386,155 K1058R probably benign Het
Rad17 A T 13: 100,622,875 F548Y probably damaging Het
Rad54b T G 4: 11,569,859 S58R possibly damaging Het
Rbm20 G A 19: 53,851,265 G895D probably damaging Het
Rgs22 T C 15: 36,103,890 probably null Het
Rhobtb3 A G 13: 75,910,666 S338P probably benign Het
Ruvbl2 A G 7: 45,424,949 probably null Het
Slc22a28 A G 19: 8,064,510 L444P possibly damaging Het
Slc44a4 A T 17: 34,928,068 Q358L probably null Het
Sowaha A G 11: 53,478,398 F504L probably benign Het
Syne1 A G 10: 5,175,789 L6035P probably damaging Het
Thbs2 A T 17: 14,689,767 M190K possibly damaging Het
Tmem171 A G 13: 98,688,442 F227L possibly damaging Het
Trp53 A G 11: 69,588,481 K162E possibly damaging Het
Ttn T A 2: 76,894,388 K2098* probably null Het
Usp30 T C 5: 114,103,760 S88P probably benign Het
Zfp276 C A 8: 123,254,904 D63E probably benign Het
Other mutations in Slc16a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Slc16a12 APN 19 34672684 missense possibly damaging 0.57
IGL01728:Slc16a12 APN 19 34690671 missense possibly damaging 0.71
PIT1430001:Slc16a12 UTSW 19 34677359 missense possibly damaging 0.50
R0017:Slc16a12 UTSW 19 34672698 splice site probably benign
R0122:Slc16a12 UTSW 19 34674864 missense probably benign 0.03
R0140:Slc16a12 UTSW 19 34672704 splice site probably benign
R1669:Slc16a12 UTSW 19 34680381 missense probably benign 0.33
R1824:Slc16a12 UTSW 19 34670878 missense possibly damaging 0.89
R4033:Slc16a12 UTSW 19 34675167 missense probably damaging 1.00
R4669:Slc16a12 UTSW 19 34672565 missense probably damaging 1.00
R4703:Slc16a12 UTSW 19 34674891 missense possibly damaging 0.94
R4832:Slc16a12 UTSW 19 34680380 missense possibly damaging 0.84
R4937:Slc16a12 UTSW 19 34675243 missense probably damaging 1.00
R4997:Slc16a12 UTSW 19 34674958 missense probably benign 0.00
R5613:Slc16a12 UTSW 19 34674958 missense probably benign 0.43
R5725:Slc16a12 UTSW 19 34674827 missense probably damaging 1.00
R6139:Slc16a12 UTSW 19 34670895 critical splice acceptor site probably null
R6417:Slc16a12 UTSW 19 34672697 critical splice acceptor site probably null
R6420:Slc16a12 UTSW 19 34672697 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACATCAGTACAGTGACAGTGGC -3'
(R):5'- ACACAGCTGCGGTGTTTAC -3'

Sequencing Primer
(F):5'- TTGAAAACTTACCTGCAATGGGTGG -3'
(R):5'- CAGTTGCGTGACTCTGTTCAAATATC -3'
Posted On2018-11-28