Incidental Mutation 'R6948:Zfp384'
ID540970
Institutional Source Beutler Lab
Gene Symbol Zfp384
Ensembl Gene ENSMUSG00000038346
Gene Namezinc finger protein 384
SynonymsC130073D16Rik, Nmp4, Ciz
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #R6948 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location125009145-125037870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125024910 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 125 (T125A)
Ref Sequence ENSEMBL: ENSMUSP00000117330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046064] [ENSMUST00000054553] [ENSMUST00000084275] [ENSMUST00000088308] [ENSMUST00000112424] [ENSMUST00000112425] [ENSMUST00000112427] [ENSMUST00000112428] [ENSMUST00000152752]
Predicted Effect probably benign
Transcript: ENSMUST00000046064
AA Change: T173A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000037986
Gene: ENSMUSG00000038346
AA Change: T173A

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054553
AA Change: T118A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086354
Gene: ENSMUSG00000038346
AA Change: T118A

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
ZnF_C2H2 174 196 7.26e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 230 252 1.95e-3 SMART
ZnF_C2H2 258 282 7.37e-4 SMART
ZnF_C2H2 288 310 5.06e-2 SMART
ZnF_C2H2 318 340 3.44e-4 SMART
low complexity region 346 404 N/A INTRINSIC
low complexity region 405 410 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084275
AA Change: T173A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000081296
Gene: ENSMUSG00000038346
AA Change: T173A

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088308
AA Change: T173A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000085648
Gene: ENSMUSG00000038346
AA Change: T173A

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112424
AA Change: T157A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108043
Gene: ENSMUSG00000038346
AA Change: T157A

DomainStartEndE-ValueType
low complexity region 172 183 N/A INTRINSIC
ZnF_C2H2 213 235 7.26e-3 SMART
ZnF_C2H2 241 263 2.99e-4 SMART
ZnF_C2H2 269 291 1.95e-3 SMART
ZnF_C2H2 302 324 7.37e-4 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 382 7.37e-4 SMART
ZnF_C2H2 388 410 5.06e-2 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
low complexity region 446 504 N/A INTRINSIC
low complexity region 505 510 N/A INTRINSIC
low complexity region 513 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112425
AA Change: T173A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108044
Gene: ENSMUSG00000038346
AA Change: T173A

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 313 337 7.37e-4 SMART
ZnF_C2H2 343 365 5.06e-2 SMART
ZnF_C2H2 373 395 3.44e-4 SMART
low complexity region 401 459 N/A INTRINSIC
low complexity region 460 465 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112427
AA Change: T173A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108046
Gene: ENSMUSG00000038346
AA Change: T173A

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112428
AA Change: T173A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000108047
Gene: ENSMUSG00000038346
AA Change: T173A

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152752
AA Change: T125A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein, which may function as a transcription factor. This gene also contains long CAG trinucleotide repeats that encode consecutive glutamine residues. The protein appears to bind and regulate the promoters of the extracellular matrix genes MMP1, MMP3, MMP7 and COL1A1. Studies in mouse suggest that nuclear matrix transcription factors (NP/NMP4) may be part of a general mechanical pathway that couples cell construction and function during extracellular matrix remodeling. Alternative splicing results in multiple transcript variants. Recurrent rearrangements of this gene with the Ewing's sarcoma gene, EWSR1 on chromosome 22, or with the TAF15 gene on chromosome 17, or with the TCF3 (E2A) gene on chromosome 19, have been observed in acute leukemia. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mice are small and males have a small testis. Some males develop infertility and exhibit variable degrees of spermatogenic cell degeneration within the seminiferous tubules and increased apoptosis of spermatogenic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap2 A G 2: 91,267,179 T107A probably benign Het
Calhm3 T A 19: 47,151,905 M250L probably damaging Het
Catsperb A T 12: 101,481,068 I276L probably benign Het
Ccdc129 C T 6: 55,978,485 T1026I probably benign Het
Cd70 T C 17: 57,149,594 E3G probably damaging Het
Cenpj A T 14: 56,553,226 S455R probably damaging Het
Cgn C G 3: 94,773,221 E590D probably benign Het
Cpvl T A 6: 53,896,483 I423F possibly damaging Het
Cyp2c54 T A 19: 40,046,192 M345L possibly damaging Het
Dner T C 1: 84,406,017 N549D probably damaging Het
Fat4 T A 3: 39,009,446 L4517Q probably damaging Het
Fbxw11 A G 11: 32,742,597 T523A probably damaging Het
Flg A G 3: 93,288,168 probably benign Het
Gcfc2 A G 6: 81,933,753 E237G probably benign Het
Ipo5 G T 14: 120,923,115 M181I probably benign Het
Klhl32 A G 4: 24,629,250 Y506H probably benign Het
Mast3 G A 8: 70,785,482 T505I probably damaging Het
Mrgprx2 A T 7: 48,482,716 V118D possibly damaging Het
Mtor T G 4: 148,536,752 V1869G probably benign Het
Mycbp2 A T 14: 103,285,267 M720K possibly damaging Het
Npy4r A G 14: 34,146,774 Y186H probably benign Het
Obscn A G 11: 59,106,316 S1520P probably damaging Het
Olfr1511 A T 14: 52,390,157 F205L probably benign Het
Pex1 A G 5: 3,605,994 N274D probably benign Het
Plxnb1 T C 9: 109,116,634 Y2078H probably damaging Het
Rasgrp1 T C 2: 117,298,604 D178G probably damaging Het
Reln A G 5: 21,972,035 S1878P probably damaging Het
Rims2 T C 15: 39,511,341 V1033A probably benign Het
Scaf1 G T 7: 45,013,547 S14* probably null Het
Serpinb9d A G 13: 33,200,723 S228G possibly damaging Het
Slc22a14 C A 9: 119,231,416 A93S probably damaging Het
Sox30 G A 11: 46,017,339 V778M probably damaging Het
Tecrl T C 5: 83,309,250 I128V probably benign Het
Trip10 T A 17: 57,262,448 C491S probably damaging Het
Vmn1r26 A T 6: 58,008,733 M157K probably damaging Het
Zbtb1 A T 12: 76,385,827 S196C probably damaging Het
Zfp236 T C 18: 82,644,062 D582G possibly damaging Het
Zpr1 T G 9: 46,273,641 probably null Het
Other mutations in Zfp384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Zfp384 APN 6 125025053 missense probably benign 0.03
IGL01568:Zfp384 APN 6 125024132 missense probably damaging 1.00
IGL01632:Zfp384 APN 6 125024761 missense probably damaging 1.00
IGL03408:Zfp384 APN 6 125035713 missense probably damaging 1.00
FR4304:Zfp384 UTSW 6 125036493 unclassified probably benign
FR4340:Zfp384 UTSW 6 125036463 unclassified probably benign
R0839:Zfp384 UTSW 6 125036668 missense probably benign 0.01
R1370:Zfp384 UTSW 6 125036453 missense probably benign 0.04
R1427:Zfp384 UTSW 6 125024884 missense probably damaging 1.00
R2441:Zfp384 UTSW 6 125036649 missense probably benign 0.01
R2986:Zfp384 UTSW 6 125024896 missense possibly damaging 0.78
R4003:Zfp384 UTSW 6 125033237 splice site probably benign
R4833:Zfp384 UTSW 6 125030848 missense probably damaging 1.00
R4860:Zfp384 UTSW 6 125030930 synonymous silent
R5084:Zfp384 UTSW 6 125023679 splice site probably benign
R5137:Zfp384 UTSW 6 125036509 unclassified probably benign
R5449:Zfp384 UTSW 6 125024138 missense probably damaging 1.00
R5558:Zfp384 UTSW 6 125036509 unclassified probably benign
R5720:Zfp384 UTSW 6 125036624 missense probably benign 0.19
R5849:Zfp384 UTSW 6 125024099 missense possibly damaging 0.91
R5961:Zfp384 UTSW 6 125024034 missense probably damaging 1.00
R6165:Zfp384 UTSW 6 125024933 unclassified probably null
R7106:Zfp384 UTSW 6 125024259 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGTCAGATGAACAGCGTGACC -3'
(R):5'- TGGCTTTGGCTCCTACCTGTAG -3'

Sequencing Primer
(F):5'- GATGAACAGCGTGACCCCATC -3'
(R):5'- TGTAGGTCTTGCCATCTTTCTG -3'
Posted On2018-11-28