Incidental Mutation 'R6948:Sox30'
ID540977
Institutional Source Beutler Lab
Gene Symbol Sox30
Ensembl Gene ENSMUSG00000040489
Gene NameSRY (sex determining region Y)-box 30
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6948 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location45980310-46017994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46017339 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 778 (V778M)
Ref Sequence ENSEMBL: ENSMUSP00000037519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049038]
Predicted Effect probably damaging
Transcript: ENSMUST00000049038
AA Change: V778M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037519
Gene: ENSMUSG00000040489
AA Change: V778M

DomainStartEndE-ValueType
low complexity region 3 36 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 50 80 N/A INTRINSIC
low complexity region 92 104 N/A INTRINSIC
low complexity region 110 141 N/A INTRINSIC
low complexity region 210 220 N/A INTRINSIC
HMG 365 435 8.35e-24 SMART
low complexity region 523 539 N/A INTRINSIC
Blast:Pept_C1 572 734 1e-92 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein acts as a transcriptional regulator when present in a complex with other proteins. It can activate p53 transcription to promote tumor cell apoptosis in lung cancer. The protein may be involved in the differentiation of developing male germ cells. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Apr 2015]
PHENOTYPE: Male mice homozygous for a null allele are infertile with arrest of spermiogenesis and azoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap2 A G 2: 91,267,179 T107A probably benign Het
Calhm3 T A 19: 47,151,905 M250L probably damaging Het
Catsperb A T 12: 101,481,068 I276L probably benign Het
Ccdc129 C T 6: 55,978,485 T1026I probably benign Het
Cd70 T C 17: 57,149,594 E3G probably damaging Het
Cenpj A T 14: 56,553,226 S455R probably damaging Het
Cgn C G 3: 94,773,221 E590D probably benign Het
Cpvl T A 6: 53,896,483 I423F possibly damaging Het
Cyp2c54 T A 19: 40,046,192 M345L possibly damaging Het
Dner T C 1: 84,406,017 N549D probably damaging Het
Fat4 T A 3: 39,009,446 L4517Q probably damaging Het
Fbxw11 A G 11: 32,742,597 T523A probably damaging Het
Flg A G 3: 93,288,168 probably benign Het
Gcfc2 A G 6: 81,933,753 E237G probably benign Het
Ipo5 G T 14: 120,923,115 M181I probably benign Het
Klhl32 A G 4: 24,629,250 Y506H probably benign Het
Mast3 G A 8: 70,785,482 T505I probably damaging Het
Mrgprx2 A T 7: 48,482,716 V118D possibly damaging Het
Mtor T G 4: 148,536,752 V1869G probably benign Het
Mycbp2 A T 14: 103,285,267 M720K possibly damaging Het
Npy4r A G 14: 34,146,774 Y186H probably benign Het
Obscn A G 11: 59,106,316 S1520P probably damaging Het
Olfr1511 A T 14: 52,390,157 F205L probably benign Het
Pex1 A G 5: 3,605,994 N274D probably benign Het
Plxnb1 T C 9: 109,116,634 Y2078H probably damaging Het
Rasgrp1 T C 2: 117,298,604 D178G probably damaging Het
Reln A G 5: 21,972,035 S1878P probably damaging Het
Rims2 T C 15: 39,511,341 V1033A probably benign Het
Scaf1 G T 7: 45,013,547 S14* probably null Het
Serpinb9d A G 13: 33,200,723 S228G possibly damaging Het
Slc22a14 C A 9: 119,231,416 A93S probably damaging Het
Tecrl T C 5: 83,309,250 I128V probably benign Het
Trip10 T A 17: 57,262,448 C491S probably damaging Het
Vmn1r26 A T 6: 58,008,733 M157K probably damaging Het
Zbtb1 A T 12: 76,385,827 S196C probably damaging Het
Zfp236 T C 18: 82,644,062 D582G possibly damaging Het
Zfp384 A G 6: 125,024,910 T125A probably benign Het
Zpr1 T G 9: 46,273,641 probably null Het
Other mutations in Sox30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Sox30 APN 11 45991900 missense possibly damaging 0.95
IGL01449:Sox30 APN 11 45981342 missense probably damaging 1.00
IGL02411:Sox30 APN 11 45981124 nonsense probably null
IGL02601:Sox30 APN 11 45984762 missense possibly damaging 0.81
IGL02747:Sox30 APN 11 45980945 missense probably benign 0.00
IGL03403:Sox30 APN 11 46017208 missense probably damaging 1.00
R0104:Sox30 UTSW 11 45981314 missense possibly damaging 0.93
R1450:Sox30 UTSW 11 46017271 missense probably damaging 0.99
R2109:Sox30 UTSW 11 45991768 missense probably damaging 0.99
R2213:Sox30 UTSW 11 45984852 missense probably damaging 1.00
R3715:Sox30 UTSW 11 45984792 missense probably damaging 0.99
R4111:Sox30 UTSW 11 46017214 missense probably benign 0.09
R4723:Sox30 UTSW 11 45984765 missense probably benign 0.03
R5014:Sox30 UTSW 11 45991909 missense probably benign 0.01
R5408:Sox30 UTSW 11 45991867 missense possibly damaging 0.54
R5974:Sox30 UTSW 11 45981073 missense probably damaging 0.99
R6063:Sox30 UTSW 11 45991942 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGACTCTCGGAGCTGTGAG -3'
(R):5'- AAGATCCCTACGCTGAGGCATC -3'

Sequencing Primer
(F):5'- TGAGAGCATGGACGGGCC -3'
(R):5'- GTCCAGGGTCACTAAGAGAACTTG -3'
Posted On2018-11-28