Incidental Mutation 'R6948:Serpinb9d'
ID540981
Institutional Source Beutler Lab
Gene Symbol Serpinb9d
Ensembl Gene ENSMUSG00000054266
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9d
SynonymsAT2, ovalbumin, Spi9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6948 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location33192959-33203129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33200723 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 228 (S228G)
Ref Sequence ENSEMBL: ENSMUSP00000067710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067198
AA Change: S228G

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067710
Gene: ENSMUSG00000054266
AA Change: S228G

DomainStartEndE-ValueType
SERPIN 13 377 1.79e-167 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap2 A G 2: 91,267,179 T107A probably benign Het
Calhm3 T A 19: 47,151,905 M250L probably damaging Het
Catsperb A T 12: 101,481,068 I276L probably benign Het
Ccdc129 C T 6: 55,978,485 T1026I probably benign Het
Cd70 T C 17: 57,149,594 E3G probably damaging Het
Cenpj A T 14: 56,553,226 S455R probably damaging Het
Cgn C G 3: 94,773,221 E590D probably benign Het
Cpvl T A 6: 53,896,483 I423F possibly damaging Het
Cyp2c54 T A 19: 40,046,192 M345L possibly damaging Het
Dner T C 1: 84,406,017 N549D probably damaging Het
Fat4 T A 3: 39,009,446 L4517Q probably damaging Het
Fbxw11 A G 11: 32,742,597 T523A probably damaging Het
Flg A G 3: 93,288,168 probably benign Het
Gcfc2 A G 6: 81,933,753 E237G probably benign Het
Ipo5 G T 14: 120,923,115 M181I probably benign Het
Klhl32 A G 4: 24,629,250 Y506H probably benign Het
Mast3 G A 8: 70,785,482 T505I probably damaging Het
Mrgprx2 A T 7: 48,482,716 V118D possibly damaging Het
Mtor T G 4: 148,536,752 V1869G probably benign Het
Mycbp2 A T 14: 103,285,267 M720K possibly damaging Het
Npy4r A G 14: 34,146,774 Y186H probably benign Het
Obscn A G 11: 59,106,316 S1520P probably damaging Het
Olfr1511 A T 14: 52,390,157 F205L probably benign Het
Pex1 A G 5: 3,605,994 N274D probably benign Het
Plxnb1 T C 9: 109,116,634 Y2078H probably damaging Het
Rasgrp1 T C 2: 117,298,604 D178G probably damaging Het
Reln A G 5: 21,972,035 S1878P probably damaging Het
Rims2 T C 15: 39,511,341 V1033A probably benign Het
Scaf1 G T 7: 45,013,547 S14* probably null Het
Slc22a14 C A 9: 119,231,416 A93S probably damaging Het
Sox30 G A 11: 46,017,339 V778M probably damaging Het
Tecrl T C 5: 83,309,250 I128V probably benign Het
Trip10 T A 17: 57,262,448 C491S probably damaging Het
Vmn1r26 A T 6: 58,008,733 M157K probably damaging Het
Zbtb1 A T 12: 76,385,827 S196C probably damaging Het
Zfp236 T C 18: 82,644,062 D582G possibly damaging Het
Zfp384 A G 6: 125,024,910 T125A probably benign Het
Zpr1 T G 9: 46,273,641 probably null Het
Other mutations in Serpinb9d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Serpinb9d APN 13 33202671 splice site probably null
IGL01610:Serpinb9d APN 13 33198002 missense probably benign 0.12
IGL01702:Serpinb9d APN 13 33203023 missense probably damaging 1.00
IGL01833:Serpinb9d APN 13 33200705 missense probably damaging 1.00
IGL02029:Serpinb9d APN 13 33196529 missense possibly damaging 0.74
IGL03013:Serpinb9d APN 13 33196538 missense probably damaging 1.00
IGL03027:Serpinb9d APN 13 33202715 nonsense probably null
IGL03056:Serpinb9d APN 13 33202753 missense probably damaging 1.00
IGL03189:Serpinb9d APN 13 33202912 missense probably damaging 1.00
IGL03206:Serpinb9d APN 13 33198031 missense possibly damaging 0.61
R0217:Serpinb9d UTSW 13 33198022 missense possibly damaging 0.79
R0370:Serpinb9d UTSW 13 33195966 missense probably damaging 1.00
R1174:Serpinb9d UTSW 13 33200625 missense probably benign 0.23
R1175:Serpinb9d UTSW 13 33200625 missense probably benign 0.23
R1711:Serpinb9d UTSW 13 33200748 missense probably benign 0.03
R1716:Serpinb9d UTSW 13 33196517 missense probably damaging 1.00
R1874:Serpinb9d UTSW 13 33197963 splice site probably null
R2186:Serpinb9d UTSW 13 33203047 missense possibly damaging 0.82
R2497:Serpinb9d UTSW 13 33196517 missense probably damaging 1.00
R4198:Serpinb9d UTSW 13 33202674 splice site probably null
R4198:Serpinb9d UTSW 13 33202965 missense probably benign 0.01
R4199:Serpinb9d UTSW 13 33202674 splice site probably null
R4584:Serpinb9d UTSW 13 33200616 missense probably damaging 1.00
R4650:Serpinb9d UTSW 13 33202853 missense probably benign 0.00
R5573:Serpinb9d UTSW 13 33196440 critical splice acceptor site probably null
R5627:Serpinb9d UTSW 13 33202693 missense probably damaging 1.00
R6336:Serpinb9d UTSW 13 33194694 missense probably damaging 1.00
R6706:Serpinb9d UTSW 13 33196558 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGATGTGGAAACCATCTGATTTC -3'
(R):5'- TTTGATCCCAAAGCCCTGTG -3'

Sequencing Primer
(F):5'- TGTGGCAGGAAGACAGATT -3'
(R):5'- GCCCACAGCTTGAAGTTCTG -3'
Posted On2018-11-28