Incidental Mutation 'R6948:Npy4r'
ID540982
Institutional Source Beutler Lab
Gene Symbol Npy4r
Ensembl Gene ENSMUSG00000048337
Gene Nameneuropeptide Y receptor Y4
SynonymsNYYR-D, Y4, Ppyr1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R6948 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34143992-34152489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34146774 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 186 (Y186H)
Ref Sequence ENSEMBL: ENSMUSP00000056576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052164]
Predicted Effect probably benign
Transcript: ENSMUST00000052164
AA Change: Y186H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056576
Gene: ENSMUSG00000048337
AA Change: Y186H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 52 337 2.5e-6 PFAM
Pfam:7tm_1 58 322 1.6e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased weight, increased drinking behavior, decreased food intake, aggression towards other mice, decreased white adipose tissue, and accelerated lobuloalveolar development during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap2 A G 2: 91,267,179 T107A probably benign Het
Calhm3 T A 19: 47,151,905 M250L probably damaging Het
Catsperb A T 12: 101,481,068 I276L probably benign Het
Ccdc129 C T 6: 55,978,485 T1026I probably benign Het
Cd70 T C 17: 57,149,594 E3G probably damaging Het
Cenpj A T 14: 56,553,226 S455R probably damaging Het
Cgn C G 3: 94,773,221 E590D probably benign Het
Cpvl T A 6: 53,896,483 I423F possibly damaging Het
Cyp2c54 T A 19: 40,046,192 M345L possibly damaging Het
Dner T C 1: 84,406,017 N549D probably damaging Het
Fat4 T A 3: 39,009,446 L4517Q probably damaging Het
Fbxw11 A G 11: 32,742,597 T523A probably damaging Het
Flg A G 3: 93,288,168 probably benign Het
Ipo5 G T 14: 120,923,115 M181I probably benign Het
Klhl32 A G 4: 24,629,250 Y506H probably benign Het
Mast3 G A 8: 70,785,482 T505I probably damaging Het
Mrgprx2 A T 7: 48,482,716 V118D possibly damaging Het
Mtor T G 4: 148,536,752 V1869G probably benign Het
Mycbp2 A T 14: 103,285,267 M720K possibly damaging Het
Obscn A G 11: 59,106,316 S1520P probably damaging Het
Olfr1511 A T 14: 52,390,157 F205L probably benign Het
Pex1 A G 5: 3,605,994 N274D probably benign Het
Plxnb1 T C 9: 109,116,634 Y2078H probably damaging Het
Rasgrp1 T C 2: 117,298,604 D178G probably damaging Het
Reln A G 5: 21,972,035 S1878P probably damaging Het
Rims2 T C 15: 39,511,341 V1033A probably benign Het
Scaf1 G T 7: 45,013,547 S14* probably null Het
Serpinb9d A G 13: 33,200,723 S228G possibly damaging Het
Sox30 G A 11: 46,017,339 V778M probably damaging Het
Tecrl T C 5: 83,309,250 I128V probably benign Het
Trip10 T A 17: 57,262,448 C491S probably damaging Het
Vmn1r26 A T 6: 58,008,733 M157K probably damaging Het
Zbtb1 A T 12: 76,385,827 S196C probably damaging Het
Zfp236 T C 18: 82,644,062 D582G possibly damaging Het
Zfp384 A G 6: 125,024,910 T125A probably benign Het
Zpr1 T G 9: 46,273,641 probably null Het
Other mutations in Npy4r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Npy4r APN 14 34146657 missense possibly damaging 0.56
IGL01449:Npy4r APN 14 34146365 missense probably damaging 1.00
IGL01982:Npy4r APN 14 34147325 missense possibly damaging 0.73
IGL03126:Npy4r APN 14 34146333 missense probably benign 0.00
R0011:Npy4r UTSW 14 34146723 missense probably damaging 0.99
R0011:Npy4r UTSW 14 34146723 missense probably damaging 0.99
R0579:Npy4r UTSW 14 34146683 missense probably benign 0.16
R2012:Npy4r UTSW 14 34147197 missense possibly damaging 0.58
R3735:Npy4r UTSW 14 34147269 missense probably benign 0.00
R4093:Npy4r UTSW 14 34147141 missense probably benign 0.21
R4650:Npy4r UTSW 14 34146224 missense possibly damaging 0.55
R4861:Npy4r UTSW 14 34146883 nonsense probably null
R4861:Npy4r UTSW 14 34146883 nonsense probably null
R4953:Npy4r UTSW 14 34146480 missense probably damaging 1.00
R4963:Npy4r UTSW 14 34147016 missense probably damaging 1.00
R5387:Npy4r UTSW 14 34146983 missense probably benign 0.21
R5973:Npy4r UTSW 14 34146707 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACACATGCTTCTGCCTCTG -3'
(R):5'- GGTGAAGTCCTTTGCAAGATG -3'

Sequencing Primer
(F):5'- CTGCAGGCGCTGGTAGATG -3'
(R):5'- CATCCAGTGTATGTCAGTGACAGTC -3'
Posted On2018-11-28