Incidental Mutation 'R6948:Cyp2c54'
ID540991
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6948 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40037941-40073811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40046192 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 345 (M345L)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048959
AA Change: M345L

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: M345L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap2 A G 2: 91,267,179 T107A probably benign Het
Calhm3 T A 19: 47,151,905 M250L probably damaging Het
Catsperb A T 12: 101,481,068 I276L probably benign Het
Ccdc129 C T 6: 55,978,485 T1026I probably benign Het
Cd70 T C 17: 57,149,594 E3G probably damaging Het
Cenpj A T 14: 56,553,226 S455R probably damaging Het
Cgn C G 3: 94,773,221 E590D probably benign Het
Cpvl T A 6: 53,896,483 I423F possibly damaging Het
Dner T C 1: 84,406,017 N549D probably damaging Het
Fat4 T A 3: 39,009,446 L4517Q probably damaging Het
Fbxw11 A G 11: 32,742,597 T523A probably damaging Het
Flg A G 3: 93,288,168 probably benign Het
Gcfc2 A G 6: 81,933,753 E237G probably benign Het
Ipo5 G T 14: 120,923,115 M181I probably benign Het
Klhl32 A G 4: 24,629,250 Y506H probably benign Het
Mast3 G A 8: 70,785,482 T505I probably damaging Het
Mrgprx2 A T 7: 48,482,716 V118D possibly damaging Het
Mtor T G 4: 148,536,752 V1869G probably benign Het
Mycbp2 A T 14: 103,285,267 M720K possibly damaging Het
Npy4r A G 14: 34,146,774 Y186H probably benign Het
Obscn A G 11: 59,106,316 S1520P probably damaging Het
Olfr1511 A T 14: 52,390,157 F205L probably benign Het
Pex1 A G 5: 3,605,994 N274D probably benign Het
Plxnb1 T C 9: 109,116,634 Y2078H probably damaging Het
Rasgrp1 T C 2: 117,298,604 D178G probably damaging Het
Reln A G 5: 21,972,035 S1878P probably damaging Het
Rims2 T C 15: 39,511,341 V1033A probably benign Het
Scaf1 G T 7: 45,013,547 S14* probably null Het
Serpinb9d A G 13: 33,200,723 S228G possibly damaging Het
Slc22a14 C A 9: 119,231,416 A93S probably damaging Het
Sox30 G A 11: 46,017,339 V778M probably damaging Het
Tecrl T C 5: 83,309,250 I128V probably benign Het
Trip10 T A 17: 57,262,448 C491S probably damaging Het
Vmn1r26 A T 6: 58,008,733 M157K probably damaging Het
Zbtb1 A T 12: 76,385,827 S196C probably damaging Het
Zfp236 T C 18: 82,644,062 D582G possibly damaging Het
Zfp384 A G 6: 125,024,910 T125A probably benign Het
Zpr1 T G 9: 46,273,641 probably null Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40072078 missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40047543 missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40072365 critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40070228 missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40047658 splice site probably benign
R0097:Cyp2c54 UTSW 19 40047659 splice site probably benign
R0391:Cyp2c54 UTSW 19 40072169 missense possibly damaging 0.61
R0581:Cyp2c54 UTSW 19 40047555 missense probably benign 0.23
R0787:Cyp2c54 UTSW 19 40047635 missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40046185 missense probably damaging 1.00
R1481:Cyp2c54 UTSW 19 40047588 missense probably benign 0.30
R1604:Cyp2c54 UTSW 19 40070343 missense probably benign 0.01
R3624:Cyp2c54 UTSW 19 40070244 missense probably benign 0.21
R3871:Cyp2c54 UTSW 19 40072423 missense probably benign 0.37
R3983:Cyp2c54 UTSW 19 40046255 missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40072171 missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40038259 missense probably benign 0.04
R4962:Cyp2c54 UTSW 19 40072141 missense possibly damaging 0.90
R5203:Cyp2c54 UTSW 19 40072474 missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40072414 missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40073762 missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40047561 missense probably benign
R6754:Cyp2c54 UTSW 19 40071560 missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40070259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATCCCATCCATGAATCAGCATAAGG -3'
(R):5'- CACTTTAAGGCACCTTCATTATGC -3'

Sequencing Primer
(F):5'- GGCACTCATAGCACTATATGACTCTG -3'
(R):5'- CACCTTTCACTGTGACCA -3'
Posted On2018-11-28