Incidental Mutation 'R6899:Ero1l'
ID541031
Institutional Source Beutler Lab
Gene Symbol Ero1l
Ensembl Gene ENSMUSG00000021831
Gene NameERO1-like (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R6899 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location45283087-45318771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 45292939 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 345 (H345Q)
Ref Sequence ENSEMBL: ENSMUSP00000022378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022378]
Predicted Effect probably benign
Transcript: ENSMUST00000022378
AA Change: H345Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022378
Gene: ENSMUSG00000021831
AA Change: H345Q

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:ERO1 60 453 3.7e-128 PFAM
Predicted Effect
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a member of the endoplasmic reticulum oxidoreductin family. The encoded protein is localized to the endoplasmic reticulum and promotes the formation of disulfide bonds by oxidizing protein disulfide isomerase. This gene may play a role in endoplasmic reticulum stress-induced apoptosis and the cellular response to hypoxia. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased apoptosis and calcium release in macrophages exposed to endoplasmic reticulum stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,784 E121G possibly damaging Het
Abca16 A G 7: 120,527,041 Y1140C probably damaging Het
Actl9 G A 17: 33,433,559 G198S probably damaging Het
Adcy2 A T 13: 68,982,381 M129K probably damaging Het
Apmap T A 2: 150,594,308 I107F probably benign Het
Arrdc3 T C 13: 80,889,211 I162T probably damaging Het
Asprv1 T C 6: 86,628,760 L196P probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Borcs5 T A 6: 134,710,210 M177K probably benign Het
C8b A T 4: 104,786,874 K246M probably benign Het
Cdo1 A G 18: 46,723,340 C76R probably damaging Het
Ces2b T A 8: 104,836,766 probably null Het
Csf2rb G A 15: 78,340,702 S194N probably benign Het
Dap3 A G 3: 88,933,600 F77L probably benign Het
Dars A G 1: 128,413,746 V44A possibly damaging Het
Dhtkd1 T A 2: 5,917,965 D461V possibly damaging Het
Fam173b A G 15: 31,617,111 S163G probably benign Het
Fzd8 T A 18: 9,214,729 S604T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gramd1c T A 16: 44,040,142 Y64F probably benign Het
Heatr5b T A 17: 78,803,509 Y970F probably benign Het
Hoxc10 A G 15: 102,967,507 E217G possibly damaging Het
Hsd17b14 A T 7: 45,562,928 H128L possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifna9 A G 4: 88,592,063 F108S probably damaging Het
Ikbke A G 1: 131,275,762 V58A probably damaging Het
Inpp5e G A 2: 26,400,048 R462C possibly damaging Het
Junb A G 8: 84,977,724 F236L probably benign Het
Klhl36 T C 8: 119,870,142 V194A probably benign Het
Lsg1 A T 16: 30,582,088 D134E probably benign Het
Megf8 G T 7: 25,360,713 C2343F probably damaging Het
Myom3 G A 4: 135,803,292 G1172R probably damaging Het
Nasp A T 4: 116,604,333 V548E probably damaging Het
Nubpl T A 12: 52,310,753 S317T probably benign Het
Nup210l A G 3: 90,167,897 D838G possibly damaging Het
Oxsr1 C T 9: 119,247,122 A373T probably benign Het
Psat1 C T 19: 15,918,205 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Slain1 C T 14: 103,650,779 P45L possibly damaging Het
Slc16a8 A G 15: 79,253,749 V20A possibly damaging Het
Slc22a13 A T 9: 119,196,407 M145K probably damaging Het
Slc22a4 G A 11: 53,988,913 T440I probably damaging Het
Slc39a12 C T 2: 14,389,541 P74L probably damaging Het
Sod3 A G 5: 52,368,708 T250A unknown Het
Syne2 A G 12: 76,095,729 probably null Het
Tctn1 A G 5: 122,248,956 Y299H probably damaging Het
Tfcp2l1 A G 1: 118,675,575 M448V probably benign Het
Tfpi C T 2: 84,444,809 G152S probably damaging Het
Thap4 A G 1: 93,750,969 S32P probably damaging Het
Tmem132c T A 5: 127,551,680 W549R probably damaging Het
Vmn2r29 T C 7: 7,241,642 E411G probably damaging Het
Washc4 C A 10: 83,576,055 D683E probably benign Het
Wdr3 A T 3: 100,149,901 V462D possibly damaging Het
Wdr5b T C 16: 36,041,780 S90P probably damaging Het
Zfp407 A G 18: 84,561,434 L518P possibly damaging Het
Zfp53 A G 17: 21,508,445 I247V possibly damaging Het
Other mutations in Ero1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Ero1l APN 14 45303586 missense probably benign 0.19
IGL01672:Ero1l APN 14 45292430 missense probably benign 0.05
IGL01914:Ero1l APN 14 45306612 missense probably damaging 1.00
IGL01979:Ero1l APN 14 45287744 missense probably damaging 1.00
IGL02302:Ero1l APN 14 45293162 missense probably benign 0.34
IGL03351:Ero1l APN 14 45294533 missense probably benign
R0844:Ero1l UTSW 14 45293000 missense probably damaging 1.00
R1696:Ero1l UTSW 14 45299935 missense probably damaging 1.00
R1828:Ero1l UTSW 14 45287760 missense probably damaging 1.00
R2410:Ero1l UTSW 14 45305266 missense possibly damaging 0.89
R2504:Ero1l UTSW 14 45299088 splice site probably null
R3415:Ero1l UTSW 14 45287866 missense possibly damaging 0.91
R3417:Ero1l UTSW 14 45287866 missense possibly damaging 0.91
R4074:Ero1l UTSW 14 45292436 splice site probably null
R6369:Ero1l UTSW 14 45299958 missense probably damaging 0.99
R7052:Ero1l UTSW 14 45306583 nonsense probably null
R7064:Ero1l UTSW 14 45306592 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCAAATCCAAGCTATTCTAGAAGC -3'
(R):5'- TTCTGACTGAAGGAGAAGGCC -3'

Sequencing Primer
(F):5'- CCAAGCTATTCTAGAAGCTCTGGG -3'
(R):5'- CCACGAAGGCTGAGGAACTTG -3'
Posted On2018-11-28