Incidental Mutation 'R0069:Ube2e3'
ID54110
Institutional Source Beutler Lab
Gene Symbol Ube2e3
Ensembl Gene ENSMUSG00000027011
Gene Nameubiquitin-conjugating enzyme E2E 3
SynonymsubcM2, Ubce4
MMRRC Submission 038360-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.593) question?
Stock #R0069 (G1)
Quality Score59
Status Validated (trace)
Chromosome2
Chromosomal Location78868124-78921293 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 78919949 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028398] [ENSMUST00000121433]
Predicted Effect probably benign
Transcript: ENSMUST00000028398
SMART Domains Protein: ENSMUSP00000028398
Gene: ENSMUSG00000027011

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
UBCc 64 207 3.91e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121433
SMART Domains Protein: ENSMUSP00000113463
Gene: ENSMUSG00000027011

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
UBCc 64 207 3.91e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153266
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse and rat counterparts, which indicates that this enzyme is highly conserved in eukaryotes. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
Creb1 A G 1: 64,576,208 I240V possibly damaging Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Ebf2 A T 14: 67,410,050 R349S probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ifi206 A T 1: 173,486,847 V9D probably damaging Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Lzts3 T A 2: 130,636,540 T213S probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr1335 A T 4: 118,809,690 V58D probably damaging Het
Olfr952 A G 9: 39,426,892 Y60H probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prox1 A G 1: 190,160,919 V443A possibly damaging Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slfn10-ps A G 11: 83,035,542 noncoding transcript Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sult1e1 A T 5: 87,579,897 H175Q probably damaging Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Xpnpep3 T C 15: 81,430,798 V233A probably benign Het
Zfp329 A T 7: 12,810,932 S222T probably damaging Het
Zswim6 T C 13: 107,738,563 noncoding transcript Het
Other mutations in Ube2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02619:Ube2e3 APN 2 78918721 missense probably damaging 1.00
R0069:Ube2e3 UTSW 2 78919949 splice site probably benign
R0586:Ube2e3 UTSW 2 78919990 missense probably benign 0.41
R4609:Ube2e3 UTSW 2 78918712 missense probably damaging 1.00
R6918:Ube2e3 UTSW 2 78920039 missense probably damaging 1.00
R7136:Ube2e3 UTSW 2 78913741 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCAATTTCAGAAGTCCCTACCCCAG -3'
(R):5'- AAGGCTATAAAGATCCGCAGCACAG -3'

Sequencing Primer
(F):5'- ATGAGCCCCTGATAGGTTACATC -3'
(R):5'- CGCAGCACAGTGGGAAG -3'
Posted On2013-07-01