Incidental Mutation 'R6925:Syne1'
ID541102
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Namespectrin repeat containing, nuclear envelope 1
SynonymsA330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6925 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location5020917-5551482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5126682 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 6879 (V6879A)
Ref Sequence ENSEMBL: ENSMUSP00000150262 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000215295
AA Change: V6879A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215467
AA Change: V1113A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,222,707 Q177R possibly damaging Het
Acat1 A T 9: 53,592,029 V170E probably benign Het
Atp2b2 T A 6: 113,760,720 I902F probably damaging Het
Cacna1d A G 14: 30,051,637 V1697A probably benign Het
Ccdc14 T A 16: 34,690,749 F31Y probably benign Het
Ccdc17 T A 4: 116,598,210 V250E probably damaging Het
Cct7 A G 6: 85,459,182 N25S probably damaging Het
Cep19 G C 16: 32,103,942 G9R probably damaging Het
Chd1l T G 3: 97,582,826 E471A probably damaging Het
Chd6 A G 2: 161,013,127 I787T probably damaging Het
Cntnap5c A C 17: 58,395,266 T1194P probably benign Het
Col6a3 T A 1: 90,816,002 M208L probably benign Het
Coro7 A T 16: 4,628,674 probably null Het
Csrnp2 T C 15: 100,481,958 K484R probably benign Het
Cyp2c39 T A 19: 39,513,195 V64E probably damaging Het
Ddr2 T C 1: 169,998,132 K300E probably benign Het
Ddx56 T C 11: 6,263,980 E393G probably damaging Het
Diaph1 A C 18: 37,853,679 Y1084* probably null Het
Disp1 A T 1: 183,086,478 F1459L probably benign Het
Dnajc8 G A 4: 132,544,113 A80T probably damaging Het
Elfn1 T A 5: 139,971,685 M148K probably benign Het
Emcn T A 3: 137,419,002 I154N probably damaging Het
Enah C G 1: 181,905,898 probably null Het
Enah T A 1: 181,905,899 probably null Het
Ep300 C A 15: 81,649,981 Q2080K probably benign Het
Epha2 T A 4: 141,308,757 M168K probably benign Het
Ercc6 T A 14: 32,562,608 I776N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat4 G T 3: 38,996,204 probably null Het
G3bp1 A G 11: 55,497,960 R333G possibly damaging Het
Gm3604 A G 13: 62,369,390 F385L probably benign Het
Gm5800 T C 14: 51,713,700 I147M possibly damaging Het
Hipk1 A G 3: 103,778,245 F18S unknown Het
Ighv3-8 A T 12: 114,322,330 C131S probably benign Het
Il23r T G 6: 67,423,493 T618P probably damaging Het
Il31ra G A 13: 112,527,529 T538I possibly damaging Het
Kcns2 A G 15: 34,839,913 D474G unknown Het
Klc4 T C 17: 46,636,229 T407A possibly damaging Het
Klra5 C T 6: 129,911,457 S2N probably benign Het
Krt10 T C 11: 99,388,851 Y161C probably damaging Het
Kxd1 A T 8: 70,523,278 M1K probably null Het
Lgals1 A C 15: 78,928,040 D27A possibly damaging Het
Lgr5 T C 10: 115,466,346 S308G probably benign Het
Lrp1 G A 10: 127,556,988 S2736L probably benign Het
Lrpap1 G T 5: 35,102,536 H73N probably benign Het
Mcpt1 C A 14: 56,019,065 T86K probably damaging Het
Megf6 A T 4: 154,254,587 D527V probably damaging Het
Mical3 A T 6: 120,959,390 S1392T probably benign Het
Mmp2 A T 8: 92,839,382 D437V probably damaging Het
Mob4 T A 1: 55,152,722 Y166* probably null Het
Mrap2 G A 9: 87,182,474 M89I possibly damaging Het
Mug1 G A 6: 121,881,787 A1155T probably damaging Het
Myh2 G T 11: 67,193,218 A1556S probably benign Het
Nfatc3 A G 8: 106,119,322 D1028G probably benign Het
Nlrp1a A T 11: 71,092,513 L1209Q probably null Het
Npr2 C T 4: 43,647,553 R819C probably damaging Het
Nsd2 A T 5: 33,879,110 D646V probably damaging Het
Nsun7 A G 5: 66,277,072 H252R probably damaging Het
Olfr267 A T 4: 58,785,647 I25N possibly damaging Het
Olfr447 T A 6: 42,911,857 C111* probably null Het
Olfr642 C T 7: 104,049,740 V205I probably benign Het
Olfr951 A T 9: 39,393,860 Q20L probably benign Het
Olfr951 G T 9: 39,393,861 Q20H probably benign Het
Pcdhga2 A T 18: 37,670,585 D494V probably damaging Het
Pcsk2 A G 2: 143,813,747 E617G probably damaging Het
Pdc T C 1: 150,333,180 I138T probably damaging Het
Phc2 T A 4: 128,748,134 S750T probably damaging Het
Pkd2l1 T A 19: 44,191,508 N88Y possibly damaging Het
Plcl1 C T 1: 55,406,598 R71* probably null Het
Prag1 C A 8: 36,103,894 L544M probably damaging Het
Prkg2 A G 5: 98,966,510 probably null Het
Psd2 G A 18: 35,979,711 S153N probably damaging Het
Rab11fip1 A T 8: 27,152,972 S600T probably damaging Het
Rbms1 T G 2: 60,762,304 T222P probably benign Het
Slfn8 A T 11: 83,013,417 Y382* probably null Het
Socs4 T A 14: 47,289,738 C43* probably null Het
Sorl1 T A 9: 42,033,626 T868S probably damaging Het
St6gal1 A G 16: 23,356,213 Y267C probably damaging Het
Syne2 C A 12: 75,854,132 H22N possibly damaging Het
Tmeff2 T A 1: 50,928,021 L25Q probably damaging Het
Tmprss11g G T 5: 86,487,426 D396E probably benign Het
Tmprss11g T A 5: 86,487,436 H393L probably benign Het
Vmn2r23 A G 6: 123,704,553 E140G probably damaging Het
Wapl T C 14: 34,677,363 S130P probably benign Het
Zeb2 T A 2: 44,994,529 K982M probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp719 T C 7: 43,590,706 S573P probably damaging Het
Zfp979 A T 4: 147,613,542 C237S possibly damaging Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5342167 synonymous probably benign
IGL00725:Syne1 APN 10 5344922 missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5347878 missense probably benign 0.00
IGL01087:Syne1 APN 10 5425708 missense probably damaging 1.00
IGL01123:Syne1 APN 10 5344921 nonsense probably null
IGL01147:Syne1 APN 10 5052691 nonsense probably null
IGL01150:Syne1 APN 10 5443154 missense probably damaging 1.00
IGL01154:Syne1 APN 10 5360848 missense probably damaging 1.00
IGL01727:Syne1 APN 10 5047842 missense probably damaging 0.99
IGL01761:Syne1 APN 10 5405456 missense probably damaging 1.00
IGL01793:Syne1 APN 10 5352191 missense possibly damaging 0.67
IGL01961:Syne1 APN 10 5043723 missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5068908 intron probably benign
IGL02152:Syne1 APN 10 5424382 missense probably damaging 1.00
IGL02423:Syne1 APN 10 5368295 missense probably benign 0.00
IGL02457:Syne1 APN 10 5342167 missense probably damaging 1.00
IGL02543:Syne1 APN 10 5043618 missense probably damaging 0.97
IGL02836:Syne1 APN 10 5409875 splice site probably benign
IGL03141:Syne1 APN 10 5424261 missense probably damaging 1.00
FR4548:Syne1 UTSW 10 5032969 missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5359059 missense probably damaging 1.00
R0004:Syne1 UTSW 10 5443132 splice site probably benign
R0110:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0165:Syne1 UTSW 10 5033096 missense probably benign 0.28
R0194:Syne1 UTSW 10 5424311 missense probably benign
R0311:Syne1 UTSW 10 5348943 missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5348945 missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5541989 missense probably damaging 1.00
R0387:Syne1 UTSW 10 5351029 missense probably benign
R0452:Syne1 UTSW 10 5405435 missense probably damaging 0.98
R0456:Syne1 UTSW 10 5342252 missense probably benign 0.04
R0457:Syne1 UTSW 10 5022041 missense probably damaging 1.00
R0469:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0510:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0533:Syne1 UTSW 10 5358438 missense probably benign 0.00
R0617:Syne1 UTSW 10 5350933 missense probably damaging 1.00
R0690:Syne1 UTSW 10 5033138 splice site probably benign
R0964:Syne1 UTSW 10 5043652 missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5349044 missense possibly damaging 0.77
R1327:Syne1 UTSW 10 5048925 splice site probably benign
R1339:Syne1 UTSW 10 5367571 missense probably damaging 1.00
R1531:Syne1 UTSW 10 5347875 nonsense probably null
R1558:Syne1 UTSW 10 5349280 nonsense probably null
R1633:Syne1 UTSW 10 5349388 missense probably damaging 1.00
R1642:Syne1 UTSW 10 5348694 missense possibly damaging 0.94
R1658:Syne1 UTSW 10 5367616 missense probably benign 0.03
R1753:Syne1 UTSW 10 5367621 missense probably benign 0.28
R1759:Syne1 UTSW 10 5349369 missense probably damaging 1.00
R1792:Syne1 UTSW 10 5040975 missense probably damaging 1.00
R2076:Syne1 UTSW 10 5040897 missense probably damaging 0.99
R2079:Syne1 UTSW 10 5361502 missense probably benign 0.01
R2102:Syne1 UTSW 10 5056514 missense probably damaging 1.00
R2233:Syne1 UTSW 10 5041484 missense probably benign 0.01
R2305:Syne1 UTSW 10 5047573 missense probably damaging 0.97
R3435:Syne1 UTSW 10 5348565 missense probably damaging 1.00
R3749:Syne1 UTSW 10 5052267 splice site probably benign
R3876:Syne1 UTSW 10 5052345 missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5405456 missense probably damaging 0.98
R3974:Syne1 UTSW 10 5043630 missense probably benign 0.06
R4042:Syne1 UTSW 10 5041584 missense probably benign 0.21
R4120:Syne1 UTSW 10 5409798 missense probably damaging 1.00
R4201:Syne1 UTSW 10 5347870 missense probably benign
R4364:Syne1 UTSW 10 5353987 missense probably damaging 0.96
R4498:Syne1 UTSW 10 5031768 missense probably benign 0.00
R4767:Syne1 UTSW 10 5344866 nonsense probably null
R4804:Syne1 UTSW 10 5349310 missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5057909 missense probably damaging 1.00
R4930:Syne1 UTSW 10 5052777 missense probably damaging 0.99
R5081:Syne1 UTSW 10 5047767 missense probably benign 0.04
R5089:Syne1 UTSW 10 5405444 nonsense probably null
R5174:Syne1 UTSW 10 5041490 missense probably damaging 0.99
R5205:Syne1 UTSW 10 5052295 missense probably benign 0.05
R5303:Syne1 UTSW 10 5420464 missense probably benign 0.00
R5384:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5385:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5392:Syne1 UTSW 10 5348661 missense probably damaging 1.00
R5442:Syne1 UTSW 10 5343473 missense probably benign 0.09
R5750:Syne1 UTSW 10 5339209 missense probably benign 0.01
R5935:Syne1 UTSW 10 5360706 unclassified probably null
R6015:Syne1 UTSW 10 5346819 critical splice donor site probably null
R6023:Syne1 UTSW 10 5443223 missense probably benign 0.09
R6049:Syne1 UTSW 10 5347926 missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5348994 missense probably damaging 1.00
R6145:Syne1 UTSW 10 5052750 missense probably damaging 1.00
R6164:Syne1 UTSW 10 5061429 missense probably damaging 1.00
R6165:Syne1 UTSW 10 5425678 missense probably damaging 1.00
R6198:Syne1 UTSW 10 5302269 missense probably damaging 0.99
R6217:Syne1 UTSW 10 5293761 missense probably benign 0.00
R6247:Syne1 UTSW 10 5349071 missense probably damaging 0.98
R6271:Syne1 UTSW 10 5234652 missense probably damaging 1.00
R6338:Syne1 UTSW 10 5255475 missense probably benign 0.00
R6344:Syne1 UTSW 10 5022212 missense probably benign 0.08
R6434:Syne1 UTSW 10 5318422 missense probably benign 0.01
R6476:Syne1 UTSW 10 5154531 missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5231679 nonsense probably null
R6479:Syne1 UTSW 10 5456826 missense probably damaging 1.00
R6546:Syne1 UTSW 10 5218645 nonsense probably null
R6578:Syne1 UTSW 10 5405454 nonsense probably null
R6611:Syne1 UTSW 10 5045273 missense probably benign 0.01
R6615:Syne1 UTSW 10 5301340 missense probably damaging 0.98
R6632:Syne1 UTSW 10 5215667 critical splice donor site probably null
R6662:Syne1 UTSW 10 5128416 missense probably damaging 1.00
R6677:Syne1 UTSW 10 5040942 missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5229011 nonsense probably null
R6765:Syne1 UTSW 10 5143285 intron probably null
R6778:Syne1 UTSW 10 5102406 missense probably damaging 0.97
R6851:Syne1 UTSW 10 5262703 nonsense probably null
R6878:Syne1 UTSW 10 5420388 missense possibly damaging 0.78
R6885:Syne1 UTSW 10 5231704 nonsense probably null
R6910:Syne1 UTSW 10 5048887 missense probably benign 0.01
R6916:Syne1 UTSW 10 5227912 missense probably benign 0.00
R6943:Syne1 UTSW 10 5083940 missense probably benign
R6947:Syne1 UTSW 10 5175789 missense probably damaging 1.00
R6965:Syne1 UTSW 10 5229120 missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5117041 missense probably benign 0.09
R7043:Syne1 UTSW 10 5072193 missense possibly damaging 0.77
R7059:Syne1 UTSW 10 5346859 missense probably damaging 1.00
R7067:Syne1 UTSW 10 5234586 missense probably damaging 1.00
R7087:Syne1 UTSW 10 5542024
R7099:Syne1 UTSW 10 5123744 missense not run
R7107:Syne1 UTSW 10 5132078 missense not run
R7120:Syne1 UTSW 10 5293971 missense not run
R7127:Syne1 UTSW 10 5243180 missense not run
R7128:Syne1 UTSW 10 5243180 missense not run
R7131:Syne1 UTSW 10 5228221 missense not run
R7132:Syne1 UTSW 10 5243180 missense not run
R7133:Syne1 UTSW 10 5231592 missense not run
R7135:Syne1 UTSW 10 5233409 missense not run
R7147:Syne1 UTSW 10 5249340 missense not run
X0017:Syne1 UTSW 10 5346917 missense probably damaging 1.00
X0025:Syne1 UTSW 10 5358973 nonsense probably null
X0063:Syne1 UTSW 10 5052354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTTAGGAAGAAACGCCATC -3'
(R):5'- TGACAAGGACCCTCCGTATG -3'

Sequencing Primer
(F):5'- AACGCCATCTGATGTGGG -3'
(R):5'- CAAGGACCCTCCGTATGTAGAATTG -3'
Posted On2018-11-28