Incidental Mutation 'R6925:Diaph1'
ID541133
Institutional Source Beutler Lab
Gene Symbol Diaph1
Ensembl Gene ENSMUSG00000024456
Gene Namediaphanous related formin 1
SynonymsDrf1, Dia1, D18Wsu154e, mDia1, Diap1, p140mDia
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6925 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37843601-37935476 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 37853679 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1084 (Y1084*)
Ref Sequence ENSEMBL: ENSMUSP00000111297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025337] [ENSMUST00000080033] [ENSMUST00000115629] [ENSMUST00000115631] [ENSMUST00000115634]
PDB Structure
Crystal structure of the core FH2 domain of mouse mDia1 [X-RAY DIFFRACTION]
Crystal structure of mDIA1 GBD-FH3 in complex with RhoC-GMPPNP [X-RAY DIFFRACTION]
Crystal structure of the N-terminal mDia1 Armadillo Repeat Region and Dimerisation Domain in complex with the mDia1 autoregulatory domain (DAD) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE DIMERIC REGULATORY DOMAIN OF MOUSE DIAPHANEOUS-RELATED FORMIN (DRF), MDIA1 [X-RAY DIFFRACTION]
Crystal structure of the autoinhibitory switch in Formin mDia1; the DID/DAD complex [X-RAY DIFFRACTION]
Mouse Profilin IIa in complex with a double repeat from the FH1 domain of mDia1 [X-RAY DIFFRACTION]
Crystal structure of MDIA1-TSH GBD-FH3 in complex with CDC42-GMPPNP [X-RAY DIFFRACTION]
Crystal structure of complex between amino and carboxy terminal fragments of mDia1 [X-RAY DIFFRACTION]
Autoinhibited Formin mDia1 Structure [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000025337
AA Change: Y1093*
SMART Domains Protein: ENSMUSP00000025337
Gene: ENSMUSG00000024456
AA Change: Y1093*

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 84 268 1.07e-57 SMART
Drf_FH3 274 466 2.06e-68 SMART
coiled coil region 471 571 N/A INTRINSIC
Pfam:Drf_FH1 609 756 6.1e-43 PFAM
FH2 761 1206 2.46e-182 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080033
AA Change: Y1084*
SMART Domains Protein: ENSMUSP00000078942
Gene: ENSMUSG00000024456
AA Change: Y1084*

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 7.9e-52 PFAM
FH2 752 1197 3.73e-182 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115629
AA Change: Y1049*
SMART Domains Protein: ENSMUSP00000111292
Gene: ENSMUSG00000024456
AA Change: Y1049*

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 7.6e-52 PFAM
FH2 717 1162 3.73e-182 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115631
AA Change: Y1049*
SMART Domains Protein: ENSMUSP00000111294
Gene: ENSMUSG00000024456
AA Change: Y1049*

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 1.1e-51 PFAM
FH2 717 1162 2.46e-182 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115634
AA Change: Y1084*
SMART Domains Protein: ENSMUSP00000111297
Gene: ENSMUSG00000024456
AA Change: Y1084*

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 9.4e-52 PFAM
FH2 752 1197 2.46e-182 SMART
Meta Mutation Damage Score 0.6 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: This gene encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myeloproliferative syndrome and myelodysplastic syndromes. Trafficking of T lymphocytes to secondary lymphoid organs and egression of thymocytes from the thymus are impaired in these animals. Lack of the encoded protein in T lymphocytes and thymocytes also reduces chemotaxis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hematopoiesis, bone marrow cell morphology, spleen morphology, skin physiology, skull morphology, and postnatal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,222,707 Q177R possibly damaging Het
Acat1 A T 9: 53,592,029 V170E probably benign Het
Atp2b2 T A 6: 113,760,720 I902F probably damaging Het
Cacna1d A G 14: 30,051,637 V1697A probably benign Het
Ccdc14 T A 16: 34,690,749 F31Y probably benign Het
Ccdc17 T A 4: 116,598,210 V250E probably damaging Het
Cct7 A G 6: 85,459,182 N25S probably damaging Het
Cep19 G C 16: 32,103,942 G9R probably damaging Het
Ces5a A T 8: 93,523,057 probably null Het
Chd1l T G 3: 97,582,826 E471A probably damaging Het
Chd6 A G 2: 161,013,127 I787T probably damaging Het
Cntnap5c A C 17: 58,395,266 T1194P probably benign Het
Col6a3 T A 1: 90,816,002 M208L probably benign Het
Coro7 A T 16: 4,628,674 probably null Het
Csrnp2 T C 15: 100,481,958 K484R probably benign Het
Cyp2c39 T A 19: 39,513,195 V64E probably damaging Het
Ddr2 T C 1: 169,998,132 K300E probably benign Het
Ddx56 T C 11: 6,263,980 E393G probably damaging Het
Disp1 A T 1: 183,086,478 F1459L probably benign Het
Dnajc8 G A 4: 132,544,113 A80T probably damaging Het
Elfn1 T A 5: 139,971,685 M148K probably benign Het
Emcn T A 3: 137,419,002 I154N probably damaging Het
Enah C G 1: 181,905,898 probably null Het
Enah T A 1: 181,905,899 probably null Het
Ep300 C A 15: 81,649,981 Q2080K probably benign Het
Epha2 T A 4: 141,308,757 M168K probably benign Het
Ercc6 T A 14: 32,562,608 I776N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat4 G T 3: 38,996,204 probably null Het
G3bp1 A G 11: 55,497,960 R333G possibly damaging Het
Gm3604 A G 13: 62,369,390 F385L probably benign Het
Gm5800 T C 14: 51,713,700 I147M possibly damaging Het
Hipk1 A G 3: 103,778,245 F18S unknown Het
Ighv3-8 A T 12: 114,322,330 C131S probably benign Het
Il23r T G 6: 67,423,493 T618P probably damaging Het
Il31ra G A 13: 112,527,529 T538I possibly damaging Het
Kcns2 A G 15: 34,839,913 D474G unknown Het
Klc4 T C 17: 46,636,229 T407A possibly damaging Het
Klra5 C T 6: 129,911,457 S2N probably benign Het
Krt10 T C 11: 99,388,851 Y161C probably damaging Het
Kxd1 A T 8: 70,523,278 M1K probably null Het
Lgals1 A C 15: 78,928,040 D27A possibly damaging Het
Lgr5 T C 10: 115,466,346 S308G probably benign Het
Lrp1 G A 10: 127,556,988 S2736L probably benign Het
Lrpap1 G T 5: 35,102,536 H73N probably benign Het
Mcpt1 C A 14: 56,019,065 T86K probably damaging Het
Megf6 A T 4: 154,254,587 D527V probably damaging Het
Mical3 A T 6: 120,959,390 S1392T probably benign Het
Mmp2 A T 8: 92,839,382 D437V probably damaging Het
Mob4 T A 1: 55,152,722 Y166* probably null Het
Mrap2 G A 9: 87,182,474 M89I possibly damaging Het
Mug1 G A 6: 121,881,787 A1155T probably damaging Het
Myh2 G T 11: 67,193,218 A1556S probably benign Het
Nfatc3 A G 8: 106,119,322 D1028G probably benign Het
Ngef T G 1: 87,503,263 probably null Het
Nlrp1a A T 11: 71,092,513 L1209Q probably null Het
Npr2 C T 4: 43,647,553 R819C probably damaging Het
Nsd2 A T 5: 33,879,110 D646V probably damaging Het
Nsun7 A G 5: 66,277,072 H252R probably damaging Het
Olfr267 A T 4: 58,785,647 I25N possibly damaging Het
Olfr447 T A 6: 42,911,857 C111* probably null Het
Olfr642 C T 7: 104,049,740 V205I probably benign Het
Olfr951 A T 9: 39,393,860 Q20L probably benign Het
Olfr951 G T 9: 39,393,861 Q20H probably benign Het
Pcdhga2 A T 18: 37,670,585 D494V probably damaging Het
Pcsk2 A G 2: 143,813,747 E617G probably damaging Het
Pdc T C 1: 150,333,180 I138T probably damaging Het
Phc2 T A 4: 128,748,134 S750T probably damaging Het
Pkd2l1 T A 19: 44,191,508 N88Y possibly damaging Het
Plcl1 C T 1: 55,406,598 R71* probably null Het
Prag1 C A 8: 36,103,894 L544M probably damaging Het
Prkg2 A G 5: 98,966,510 probably null Het
Psd2 G A 18: 35,979,711 S153N probably damaging Het
Rab11fip1 A T 8: 27,152,972 S600T probably damaging Het
Rbms1 T G 2: 60,762,304 T222P probably benign Het
Slfn8 A T 11: 83,013,417 Y382* probably null Het
Socs4 T A 14: 47,289,738 C43* probably null Het
Sorl1 T A 9: 42,033,626 T868S probably damaging Het
St6gal1 A G 16: 23,356,213 Y267C probably damaging Het
Syne1 A G 10: 5,126,682 V6879A probably benign Het
Syne2 C A 12: 75,854,132 H22N possibly damaging Het
Tmeff2 T A 1: 50,928,021 L25Q probably damaging Het
Tmprss11g G T 5: 86,487,426 D396E probably benign Het
Tmprss11g T A 5: 86,487,436 H393L probably benign Het
Vmn2r23 A G 6: 123,704,553 E140G probably damaging Het
Wapl T C 14: 34,677,363 S130P probably benign Het
Zeb2 T A 2: 44,994,529 K982M probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp719 T C 7: 43,590,706 S573P probably damaging Het
Zfp979 A T 4: 147,613,542 C237S possibly damaging Het
Other mutations in Diaph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Diaph1 APN 18 37893348 critical splice donor site probably null
IGL01432:Diaph1 APN 18 37897504 missense unknown
IGL01646:Diaph1 APN 18 37893416 critical splice acceptor site probably null
IGL01676:Diaph1 APN 18 37856188 nonsense probably null
IGL01731:Diaph1 APN 18 37853709 critical splice acceptor site probably benign
IGL01921:Diaph1 APN 18 37856208 missense possibly damaging 0.73
IGL02200:Diaph1 APN 18 37890682 missense unknown
IGL02258:Diaph1 APN 18 37853330 missense probably damaging 0.99
IGL02325:Diaph1 APN 18 37853600 missense probably damaging 1.00
IGL03304:Diaph1 APN 18 37854573 missense possibly damaging 0.47
albatross UTSW 18 37853679 nonsense probably null
cucamonga UTSW 18 37896093 critical splice donor site probably null
damselfly UTSW 18 37897550 nonsense probably null
devastator UTSW 18 37896093 critical splice donor site probably null
Guangzhou UTSW 18 37896093 critical splice donor site probably null
seethrough UTSW 18 37889769 missense probably damaging 1.00
sheer UTSW 18 37896093 critical splice donor site probably benign
R0137:Diaph1 UTSW 18 37891849 missense unknown
R0446:Diaph1 UTSW 18 37853590 missense possibly damaging 0.94
R0523:Diaph1 UTSW 18 37856500 missense possibly damaging 0.56
R1433:Diaph1 UTSW 18 37905134 missense unknown
R1532:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1534:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1535:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1536:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1537:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1611:Diaph1 UTSW 18 37900702 missense unknown
R1756:Diaph1 UTSW 18 37854573 missense possibly damaging 0.47
R1771:Diaph1 UTSW 18 37891018 missense unknown
R1812:Diaph1 UTSW 18 37891018 missense unknown
R2121:Diaph1 UTSW 18 37896389 missense unknown
R3710:Diaph1 UTSW 18 37845484 missense probably damaging 1.00
R3891:Diaph1 UTSW 18 37900638 splice site probably benign
R3892:Diaph1 UTSW 18 37900638 splice site probably benign
R4077:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4079:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4771:Diaph1 UTSW 18 37853551 missense probably damaging 1.00
R4815:Diaph1 UTSW 18 37895203 missense unknown
R5242:Diaph1 UTSW 18 37851635 missense probably damaging 1.00
R5294:Diaph1 UTSW 18 37897580 missense unknown
R5294:Diaph1 UTSW 18 37897550 nonsense probably null
R5349:Diaph1 UTSW 18 37891072 missense unknown
R5427:Diaph1 UTSW 18 37890595 missense unknown
R5623:Diaph1 UTSW 18 37896093 critical splice donor site probably benign
R5677:Diaph1 UTSW 18 37855951 missense probably damaging 1.00
R5730:Diaph1 UTSW 18 37903776 missense unknown
R5767:Diaph1 UTSW 18 37853355 missense probably damaging 1.00
R5925:Diaph1 UTSW 18 37891935 missense unknown
R6151:Diaph1 UTSW 18 37853353 missense probably damaging 1.00
R6823:Diaph1 UTSW 18 37876383 intron probably null
R6876:Diaph1 UTSW 18 37896373 missense unknown
R6983:Diaph1 UTSW 18 37889769 missense probably damaging 1.00
R7073:Diaph1 UTSW 18 37889814 critical splice acceptor site probably null
R7248:Diaph1 UTSW 18 37889776 missense probably benign 0.26
R7400:Diaph1 UTSW 18 37854502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCATTAGGAACCCCACG -3'
(R):5'- ATGATTCTCTGACCTGGGCCTG -3'

Sequencing Primer
(F):5'- CGAAAAATTAGCAGTTTCCCCTTGC -3'
(R):5'- AACAGGATTTCTCTGTGTAGCTC -3'
Posted On2018-11-28