Incidental Mutation 'R6927:Zfp335'
ID541142
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6927 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164893720 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1105 (C1105R)
Ref Sequence ENSEMBL: ENSMUSP00000038298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000041643] [ENSMUST00000183830]
Predicted Effect probably damaging
Transcript: ENSMUST00000041361
AA Change: C1105R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: C1105R

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041643
SMART Domains Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849

DomainStartEndE-ValueType
WW 44 77 4.34e-4 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:PCIF1_WW 445 620 7.1e-74 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,391 W229R probably damaging Het
Adck2 T C 6: 39,584,064 probably null Het
Ahi1 A T 10: 21,055,069 N936I probably damaging Het
Ass1 T C 2: 31,514,801 S365P probably damaging Het
Atp9b T C 18: 80,891,857 K208E possibly damaging Het
Bag6 G A 17: 35,145,922 probably null Het
Bptf A T 11: 107,054,595 V2491E probably damaging Het
Cd300ld2 T A 11: 115,013,793 R83W probably damaging Het
Chrnd T C 1: 87,198,712 F396L probably damaging Het
Cyp3a13 G A 5: 137,895,284 P439S probably damaging Het
Dnhd1 C A 7: 105,715,563 H4279N probably damaging Het
Fam118a T C 15: 85,044,837 probably null Het
Fam198b T C 3: 79,941,462 I505T probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fasn T A 11: 120,808,289 D2386V probably benign Het
Fat1 G A 8: 45,024,495 V2170I probably benign Het
Fdps T C 3: 89,093,651 R374G probably benign Het
Fhl5 T C 4: 25,213,681 D85G probably benign Het
Flvcr1 T C 1: 191,025,664 M144V possibly damaging Het
Gpr31b A G 17: 13,051,878 S135P probably damaging Het
Hey2 A T 10: 30,834,417 D113E probably benign Het
Hoxc5 T A 15: 103,015,375 I201N probably damaging Het
Ighv1-50 A T 12: 115,120,174 W3R probably damaging Het
Impa1 A G 3: 10,315,288 I208T probably benign Het
Iqcj T C 3: 68,047,291 L43P possibly damaging Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Kdm4b T C 17: 56,399,435 C850R probably damaging Het
Krt25 A T 11: 99,317,379 I341N probably damaging Het
L3mbtl3 T A 10: 26,292,669 R621* probably null Het
Lipm T C 19: 34,101,163 probably benign Het
Macrod2 A T 2: 142,256,521 D286V probably damaging Het
Mad2l2 T A 4: 148,140,954 V27E possibly damaging Het
Map4k4 T A 1: 40,011,682 H768Q probably benign Het
Mgat4d A G 8: 83,354,867 N83S probably benign Het
Nucb1 C T 7: 45,498,858 R141H possibly damaging Het
Olfr325 A G 11: 58,581,665 K274E possibly damaging Het
Pcdhga2 A C 18: 37,670,666 D521A probably damaging Het
Pcnx T C 12: 81,917,812 V251A probably benign Het
Pdf A T 8: 107,048,201 M133K probably damaging Het
Piezo2 A G 18: 63,032,986 F2058S probably damaging Het
Plekhb2 T A 1: 34,876,901 probably null Het
Ppp2r3a G C 9: 101,175,348 H221D probably damaging Het
Prl2c5 A T 13: 13,182,918 probably null Het
Puf60 T A 15: 76,075,814 M49L probably benign Het
Rdh16f1 T C 10: 127,788,692 V133A probably benign Het
Robo2 T A 16: 73,982,058 D389V probably damaging Het
Slc22a23 G T 13: 34,344,379 A140D probably benign Het
Slc25a42 A G 8: 70,188,923 L136P probably damaging Het
Slc36a3 T A 11: 55,129,693 M284L probably damaging Het
Tas2r115 T A 6: 132,737,932 I19F probably damaging Het
Tmc2 A G 2: 130,261,380 H812R probably benign Het
Vmn2r26 A G 6: 124,039,098 S174G possibly damaging Het
Vstm4 T A 14: 32,864,002 probably null Het
Vwc2 C A 11: 11,154,250 P261T probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp488 A G 14: 33,970,798 L136P probably benign Het
Zzef1 G A 11: 72,913,157 R2575H probably damaging Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
PIT4403001:Zfp335 UTSW 2 164893716 missense possibly damaging 0.56
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCAAATGGTCCACTGCATG -3'
(R):5'- TCTGGTCCTCACTGACATGG -3'

Sequencing Primer
(F):5'- ATGGCCCAGGAGTAGCTTACTG -3'
(R):5'- TCCTCACTGACATGGGTTTAG -3'
Posted On2018-11-28