Incidental Mutation 'R6927:Impa1'
ID541143
Institutional Source Beutler Lab
Gene Symbol Impa1
Ensembl Gene ENSMUSG00000027531
Gene Nameinositol (myo)-1(or 4)-monophosphatase 1
Synonymslithium-sensitive myo-inositol monophosphatase A1, 2900059K10Rik, 2610002K09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6927 (G1)
Quality Score221.009
Status Not validated
Chromosome3
Chromosomal Location10311956-10331439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10315288 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 208 (I208T)
Ref Sequence ENSEMBL: ENSMUSP00000141345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065938] [ENSMUST00000118410] [ENSMUST00000191670]
Predicted Effect silent
Transcript: ENSMUST00000065938
SMART Domains Protein: ENSMUSP00000068174
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 1.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118410
SMART Domains Protein: ENSMUSP00000113860
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 7.7e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191670
AA Change: I208T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141345
Gene: ENSMUSG00000027531
AA Change: I208T

DomainStartEndE-ValueType
Pfam:Inositol_P 5 180 4.7e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that dephosphorylates myo-inositol monophosphate to generate free myo-inositol, a precursor of phosphatidylinositol, and is therefore an important modulator of intracellular signal transduction via the production of the second messengers myoinositol 1,4,5-trisphosphate and diacylglycerol. This enzyme can also use myo-inositol-1,3-diphosphate, myo-inositol-1,4-diphosphate, scyllo-inositol-phosphate, glucose-1-phosphate, glucose-6-phosphate, fructose-1-phosphate, beta-glycerophosphate, and 2'-AMP as substrates. This enzyme shows magnesium-dependent phosphatase activity and is inhibited by therapeutic concentrations of lithium. Inhibition of inositol monophosphate hydroylosis and subsequent depletion of inositol for phosphatidylinositol synthesis may explain the anti-manic and anti-depressive effects of lithium administered to treat bipolar disorder. Alternative splicing results in multiple transcript variants encoding distinct isoforms. A pseudogene of this gene is also present on chromosome 8q21.13. [provided by RefSeq, Dec 2014]
PHENOTYPE: Most mice homozygous for a knock-out allele die between E9.5 and E10.5 with surviving mice exhibiting hyperactivity, increased rearing, and increased susceptibility to pilocarpine-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,391 W229R probably damaging Het
Adck2 T C 6: 39,584,064 probably null Het
Ahi1 A T 10: 21,055,069 N936I probably damaging Het
Ass1 T C 2: 31,514,801 S365P probably damaging Het
Atp9b T C 18: 80,891,857 K208E possibly damaging Het
Bag6 G A 17: 35,145,922 probably null Het
Bptf A T 11: 107,054,595 V2491E probably damaging Het
Cd300ld2 T A 11: 115,013,793 R83W probably damaging Het
Chrnd T C 1: 87,198,712 F396L probably damaging Het
Cyp3a13 G A 5: 137,895,284 P439S probably damaging Het
Dnhd1 C A 7: 105,715,563 H4279N probably damaging Het
Fam118a T C 15: 85,044,837 probably null Het
Fam198b T C 3: 79,941,462 I505T probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fasn T A 11: 120,808,289 D2386V probably benign Het
Fat1 G A 8: 45,024,495 V2170I probably benign Het
Fdps T C 3: 89,093,651 R374G probably benign Het
Fhl5 T C 4: 25,213,681 D85G probably benign Het
Flvcr1 T C 1: 191,025,664 M144V possibly damaging Het
Gpr31b A G 17: 13,051,878 S135P probably damaging Het
Hey2 A T 10: 30,834,417 D113E probably benign Het
Hoxc5 T A 15: 103,015,375 I201N probably damaging Het
Ighv1-50 A T 12: 115,120,174 W3R probably damaging Het
Iqcj T C 3: 68,047,291 L43P possibly damaging Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Kdm4b T C 17: 56,399,435 C850R probably damaging Het
Krt25 A T 11: 99,317,379 I341N probably damaging Het
L3mbtl3 T A 10: 26,292,669 R621* probably null Het
Lipm T C 19: 34,101,163 probably benign Het
Macrod2 A T 2: 142,256,521 D286V probably damaging Het
Mad2l2 T A 4: 148,140,954 V27E possibly damaging Het
Map4k4 T A 1: 40,011,682 H768Q probably benign Het
Mgat4d A G 8: 83,354,867 N83S probably benign Het
Nucb1 C T 7: 45,498,858 R141H possibly damaging Het
Olfr325 A G 11: 58,581,665 K274E possibly damaging Het
Pcdhga2 A C 18: 37,670,666 D521A probably damaging Het
Pcnx T C 12: 81,917,812 V251A probably benign Het
Pdf A T 8: 107,048,201 M133K probably damaging Het
Piezo2 A G 18: 63,032,986 F2058S probably damaging Het
Ppp2r3a G C 9: 101,175,348 H221D probably damaging Het
Puf60 T A 15: 76,075,814 M49L probably benign Het
Rdh16f1 T C 10: 127,788,692 V133A probably benign Het
Robo2 T A 16: 73,982,058 D389V probably damaging Het
Slc22a23 G T 13: 34,344,379 A140D probably benign Het
Slc25a42 A G 8: 70,188,923 L136P probably damaging Het
Slc36a3 T A 11: 55,129,693 M284L probably damaging Het
Tas2r115 T A 6: 132,737,932 I19F probably damaging Het
Tmc2 A G 2: 130,261,380 H812R probably benign Het
Vmn2r26 A G 6: 124,039,098 S174G possibly damaging Het
Vwc2 C A 11: 11,154,250 P261T probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp335 A G 2: 164,893,720 C1105R probably damaging Het
Zfp488 A G 14: 33,970,798 L136P probably benign Het
Zzef1 G A 11: 72,913,157 R2575H probably damaging Het
Other mutations in Impa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Impa1 APN 3 10322948 missense probably damaging 1.00
IGL02411:Impa1 APN 3 10322958 missense possibly damaging 0.90
IGL02733:Impa1 APN 3 10328965 missense probably benign
IGL03183:Impa1 APN 3 10322994 missense probably damaging 1.00
lofty UTSW 3 10329004 missense probably null 1.00
R0166:Impa1 UTSW 3 10328960 missense probably damaging 0.99
R0782:Impa1 UTSW 3 10322896 splice site probably benign
R1645:Impa1 UTSW 3 10328441 missense possibly damaging 0.79
R3196:Impa1 UTSW 3 10329015 splice site probably null
R3905:Impa1 UTSW 3 10316034 missense probably benign
R4953:Impa1 UTSW 3 10315280 missense probably damaging 1.00
R5495:Impa1 UTSW 3 10326170 missense probably benign 0.08
R5884:Impa1 UTSW 3 10316224 missense probably damaging 1.00
R5972:Impa1 UTSW 3 10329004 start codon destroyed probably null 1.00
X0054:Impa1 UTSW 3 10316100 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCAGGACCTCAAAGTTCAGTC -3'
(R):5'- TCGCTAGCATTGGCCTTTAC -3'

Sequencing Primer
(F):5'- GTTCAGTCTAAATCAGTGACACC -3'
(R):5'- GGCCTTTACTCAGAAAAGATGCCTAG -3'
Posted On2018-11-28