Incidental Mutation 'R0606:Zbtb41'
ID54121
Institutional Source Beutler Lab
Gene Symbol Zbtb41
Ensembl Gene ENSMUSG00000033964
Gene Namezinc finger and BTB domain containing 41
Synonyms9830132G07Rik, 8430415N23Rik
MMRRC Submission 038795-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R0606 (G1)
Quality Score205
Status Validated
Chromosome1
Chromosomal Location139422288-139453005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139423610 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 154 (Y154H)
Ref Sequence ENSEMBL: ENSMUSP00000142797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039867] [ENSMUST00000200243]
Predicted Effect probably benign
Transcript: ENSMUST00000039867
AA Change: Y154H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045570
Gene: ENSMUSG00000033964
AA Change: Y154H

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
BTB 89 183 7.06e-16 SMART
ZnF_C2H2 208 231 3.78e-1 SMART
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 301 327 N/A INTRINSIC
ZnF_C2H2 360 382 4.17e-3 SMART
ZnF_C2H2 388 410 8.34e-3 SMART
ZnF_C2H2 421 444 2.67e-1 SMART
ZnF_C2H2 462 484 1.72e-4 SMART
ZnF_C2H2 490 513 1.41e0 SMART
ZnF_C2H2 517 540 1.12e-3 SMART
ZnF_C2H2 546 568 1.36e-2 SMART
ZnF_C2H2 574 596 2.91e-2 SMART
ZnF_C2H2 602 624 7.37e-4 SMART
ZnF_C2H2 630 653 3.39e-3 SMART
ZnF_C2H2 667 689 2.75e-3 SMART
ZnF_C2H2 695 717 3.16e-3 SMART
ZnF_C2H2 723 746 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199011
Predicted Effect probably benign
Transcript: ENSMUST00000200243
AA Change: Y154H

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142797
Gene: ENSMUSG00000033964
AA Change: Y154H

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
BTB 89 183 4.7e-18 SMART
ZnF_C2H2 208 231 1.6e-3 SMART
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 301 327 N/A INTRINSIC
ZnF_C2H2 360 382 1.7e-5 SMART
ZnF_C2H2 388 410 3.5e-5 SMART
ZnF_C2H2 421 444 1.1e-3 SMART
ZnF_C2H2 462 484 7.2e-7 SMART
ZnF_C2H2 490 513 5.9e-3 SMART
ZnF_C2H2 517 540 4.7e-6 SMART
ZnF_C2H2 546 568 5.7e-5 SMART
ZnF_C2H2 574 596 1.3e-4 SMART
ZnF_C2H2 602 624 3e-6 SMART
ZnF_C2H2 630 653 1.5e-5 SMART
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,259,089 Y128H probably damaging Het
Actl9 T C 17: 33,433,598 Y211H probably damaging Het
Actn1 A T 12: 80,174,647 probably benign Het
Adtrp A G 13: 41,767,405 F197L probably damaging Het
Ankrd11 G A 8: 122,892,832 T1406I probably benign Het
Arhgap24 A T 5: 102,897,220 R620W probably damaging Het
Atg13 A G 2: 91,682,073 Y284H probably benign Het
Atrn A G 2: 130,906,856 E99G possibly damaging Het
Cage1 A T 13: 38,016,494 probably benign Het
Ccr3 T A 9: 124,028,802 M58K probably benign Het
Cdk18 G T 1: 132,117,617 probably benign Het
Chst5 A G 8: 111,890,919 V23A probably benign Het
Col4a3 T C 1: 82,672,586 probably benign Het
Col4a6 A G X: 141,192,223 probably benign Het
Csmd3 T C 15: 48,457,662 I251V probably benign Het
Csnk1g3 G A 18: 53,917,028 V115M probably damaging Het
Cst7 A T 2: 150,570,519 M1L probably benign Het
Cyp4f17 A T 17: 32,527,843 D373V probably damaging Het
Dclk2 G A 3: 86,906,004 R212W probably damaging Het
Dhrs7b T G 11: 60,830,746 probably benign Het
Dhx58 T A 11: 100,702,251 H210L probably benign Het
Dnah9 T C 11: 65,841,333 Y4249C probably damaging Het
Eif5b T A 1: 38,048,893 L990H probably damaging Het
Faap24 T C 7: 35,394,963 probably benign Het
Fryl T A 5: 73,124,734 H174L probably benign Het
Gabrr1 T C 4: 33,132,696 W15R probably benign Het
Gif A T 19: 11,752,294 I206F possibly damaging Het
Gm15446 T C 5: 109,943,481 V533A probably benign Het
Gm6760 T A X: 64,151,653 K63* probably null Het
Gne C T 4: 44,042,244 E444K possibly damaging Het
Gpr173 T A X: 152,347,040 M146L possibly damaging Het
Hira C T 16: 18,935,047 S547L probably benign Het
Hnf1b A G 11: 83,863,984 H161R probably benign Het
Hnrnpm T A 17: 33,658,390 N53I probably damaging Het
Hs3st5 A T 10: 36,832,588 I40F probably benign Het
Hydin C T 8: 110,549,798 probably benign Het
Ift172 A G 5: 31,254,313 I1607T probably damaging Het
Igfn1 T C 1: 135,959,901 Q2475R probably damaging Het
Il6st T C 13: 112,504,272 S800P possibly damaging Het
Iqub G A 6: 24,501,261 probably benign Het
Itgb1 A T 8: 128,722,372 probably benign Het
Kctd21 G A 7: 97,347,601 E94K probably benign Het
Kir3dl2 A G X: 136,453,511 V233A possibly damaging Het
Klra2 A T 6: 131,220,224 C271S probably damaging Het
Lacc1 A T 14: 77,029,621 C401S probably damaging Het
Lmna T C 3: 88,482,578 E580G probably damaging Het
Matn2 A G 15: 34,345,150 Y101C probably damaging Het
Mrps16 G A 14: 20,391,389 R116* probably null Het
Ndrg2 G T 14: 51,906,217 R333S probably damaging Het
Nf2 A G 11: 4,782,194 I507T possibly damaging Het
Nktr A G 9: 121,749,290 probably benign Het
Nkx3-1 G A 14: 69,191,006 probably benign Het
Npat T C 9: 53,556,481 probably null Het
Nrxn1 T C 17: 90,565,373 N1047S probably damaging Het
Nup210 A T 6: 91,026,929 I1402N possibly damaging Het
Olfr1168 G T 2: 88,185,280 M134I possibly damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdcl2 C T 5: 76,312,481 S182N probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pla2g4a A G 1: 149,840,704 F669L probably benign Het
Plekha8 A G 6: 54,629,820 K367E probably damaging Het
Pola1 A G X: 93,488,087 probably benign Het
Ppm1d C T 11: 85,345,877 T494I probably benign Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prl6a1 A T 13: 27,314,194 probably benign Het
Ptprg T A 14: 12,154,131 S617R probably benign Het
R3hdm2 G A 10: 127,444,444 G45D probably damaging Het
Rev1 T A 1: 38,059,123 R780W probably null Het
Rnf139 T A 15: 58,899,827 F567Y probably damaging Het
Scarf1 T C 11: 75,514,348 V71A probably damaging Het
Shtn1 A G 19: 58,999,940 S438P probably damaging Het
Slc30a3 T A 5: 31,088,723 H221L probably benign Het
Smo A C 6: 29,753,604 I160L possibly damaging Het
Snapc5 A T 9: 64,179,300 probably benign Het
Snf8 G T 11: 96,034,973 probably benign Het
Spata31d1a T C 13: 59,702,431 S628G probably benign Het
Sphkap A T 1: 83,280,424 D199E probably damaging Het
Stxbp5l T C 16: 37,204,521 T572A possibly damaging Het
Thada C A 17: 84,416,303 V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 Q735R probably benign Het
Tmem29 C T X: 150,398,364 A144T probably benign Het
Trim24 G A 6: 37,871,234 E42K probably benign Het
Trnt1 T A 6: 106,777,908 probably benign Het
Ttbk2 A T 2: 120,773,872 M215K probably damaging Het
Ttc8 C T 12: 98,943,459 probably benign Het
Ube3c A G 5: 29,590,928 Y105C probably damaging Het
Unc13c A G 9: 73,530,983 probably benign Het
Usp36 A G 11: 118,263,028 probably benign Het
Vmn2r102 T C 17: 19,678,844 S483P possibly damaging Het
Wdr95 A G 5: 149,588,130 T432A probably damaging Het
Wnk1 G T 6: 119,926,683 P2523H probably damaging Het
Xpo4 A G 14: 57,638,208 probably benign Het
Zar1 G T 5: 72,580,543 P71Q probably damaging Het
Zer1 G T 2: 30,104,797 probably benign Het
Zfp454 A G 11: 50,874,185 F140S probably benign Het
Other mutations in Zbtb41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Zbtb41 APN 1 139430324 missense probably benign 0.01
IGL01796:Zbtb41 APN 1 139442883 missense probably damaging 0.99
IGL01844:Zbtb41 APN 1 139447327 missense probably benign 0.01
IGL02150:Zbtb41 APN 1 139440448 missense possibly damaging 0.73
IGL02346:Zbtb41 APN 1 139447100 missense probably damaging 1.00
IGL03139:Zbtb41 APN 1 139423838 missense probably benign 0.00
IGL03215:Zbtb41 APN 1 139446950 missense probably damaging 1.00
IGL03309:Zbtb41 APN 1 139432078 critical splice donor site probably null
memorialized UTSW 1 139440394 missense probably benign 0.00
Noted UTSW 1 139439031 missense probably damaging 0.99
unforgotten UTSW 1 139432078 critical splice donor site probably null
R0004:Zbtb41 UTSW 1 139442888 missense possibly damaging 0.90
R0010:Zbtb41 UTSW 1 139423530 missense probably damaging 1.00
R0010:Zbtb41 UTSW 1 139423530 missense probably damaging 1.00
R0048:Zbtb41 UTSW 1 139441834 missense probably damaging 1.00
R0230:Zbtb41 UTSW 1 139446935 missense probably damaging 1.00
R0309:Zbtb41 UTSW 1 139438984 missense probably damaging 0.99
R0458:Zbtb41 UTSW 1 139423476 missense probably damaging 1.00
R0964:Zbtb41 UTSW 1 139439031 missense probably damaging 0.99
R1531:Zbtb41 UTSW 1 139423193 missense probably benign 0.00
R1723:Zbtb41 UTSW 1 139423563 missense probably benign 0.39
R1765:Zbtb41 UTSW 1 139440394 missense probably benign 0.00
R1829:Zbtb41 UTSW 1 139446922 nonsense probably null
R2077:Zbtb41 UTSW 1 139424093 missense probably damaging 1.00
R2292:Zbtb41 UTSW 1 139440359 missense probably damaging 0.99
R2380:Zbtb41 UTSW 1 139423814 missense probably damaging 0.99
R2402:Zbtb41 UTSW 1 139423185 missense probably benign 0.10
R2402:Zbtb41 UTSW 1 139423187 nonsense probably null
R3847:Zbtb41 UTSW 1 139423996 missense probably benign
R3848:Zbtb41 UTSW 1 139423996 missense probably benign
R3849:Zbtb41 UTSW 1 139423996 missense probably benign
R4077:Zbtb41 UTSW 1 139429326 missense probably benign 0.11
R4641:Zbtb41 UTSW 1 139442819 missense probably damaging 0.98
R4772:Zbtb41 UTSW 1 139447414 missense probably damaging 1.00
R5646:Zbtb41 UTSW 1 139423763 missense probably benign 0.05
R5754:Zbtb41 UTSW 1 139432078 critical splice donor site probably null
R6002:Zbtb41 UTSW 1 139423659 missense probably damaging 1.00
R6045:Zbtb41 UTSW 1 139424032 missense probably benign 0.34
R6302:Zbtb41 UTSW 1 139429289 missense possibly damaging 0.67
R6318:Zbtb41 UTSW 1 139430306 missense possibly damaging 0.91
R6430:Zbtb41 UTSW 1 139447207 missense probably benign 0.02
R6906:Zbtb41 UTSW 1 139423390 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TGATAGGCAGAAGCAACCGTCTTTC -3'
(R):5'- ACTTGACAGGGCACTTCCGATTC -3'

Sequencing Primer
(F):5'- CGATTTACTTATCATAGTGGAAGGG -3'
(R):5'- TTTTTCCCAAGGAGCAGAGAC -3'
Posted On2013-07-11