Incidental Mutation 'R0606:Pla2g4a'
ID54122
Institutional Source Beutler Lab
Gene Symbol Pla2g4a
Ensembl Gene ENSMUSG00000056220
Gene Namephospholipase A2, group IVA (cytosolic, calcium-dependent)
SynonymsType IV PLA2, cytosolic phospholipase A2, Pla2g4, cytosolic PLA2, cPLA2alpha, cPLA2
MMRRC Submission 038795-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R0606 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location149829618-149961290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149840704 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 669 (F669L)
Ref Sequence ENSEMBL: ENSMUSP00000107557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070200] [ENSMUST00000111926]
Predicted Effect probably benign
Transcript: ENSMUST00000070200
AA Change: F677L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070868
Gene: ENSMUSG00000056220
AA Change: F677L

DomainStartEndE-ValueType
C2 19 121 8.23e-17 SMART
PLAc 117 668 N/A SMART
Blast:PLAc 706 748 3e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104328
Predicted Effect probably benign
Transcript: ENSMUST00000111926
AA Change: F669L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107557
Gene: ENSMUSG00000056220
AA Change: F669L

DomainStartEndE-ValueType
C2 11 113 8.23e-17 SMART
PLAc 109 660 N/A SMART
Blast:PLAc 698 740 3e-10 BLAST
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the phospholipase A2 group IV family. This enzyme hydrolyzes membrane phospholipids, thereby releasing the polyunsaturated fatty acid, arachidonic acid. Arachidonic acid is further metabolized into eicosanoids such as leukotrienes, thromboxanes and prostaglandins, that play important roles in regulating diverse biological processes such as inflammatory responses, membrane and actin dynamics, and tumorigenesis. A rise in intracellular calcium levels results in binding of calcium to the C2 domain of this protein, and triggers the translocation from the cytosol to intracellular membranes, including the Golgi apparatus. Disruption of this gene in mice led to decreased levels of eicosonaoids and platelet-activating factor, decreased allergic symptoms, and impaired reproductive ability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygouse for disruptions in this gene display reduced allergic and autoimmune reactions. They also display an increased incidence of insulin and reduced female reproductive performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,259,089 Y128H probably damaging Het
Actl9 T C 17: 33,433,598 Y211H probably damaging Het
Actn1 A T 12: 80,174,647 probably benign Het
Adtrp A G 13: 41,767,405 F197L probably damaging Het
Ankrd11 G A 8: 122,892,832 T1406I probably benign Het
Arhgap24 A T 5: 102,897,220 R620W probably damaging Het
Atg13 A G 2: 91,682,073 Y284H probably benign Het
Atrn A G 2: 130,906,856 E99G possibly damaging Het
Cage1 A T 13: 38,016,494 probably benign Het
Ccr3 T A 9: 124,028,802 M58K probably benign Het
Cdk18 G T 1: 132,117,617 probably benign Het
Chst5 A G 8: 111,890,919 V23A probably benign Het
Col4a3 T C 1: 82,672,586 probably benign Het
Col4a6 A G X: 141,192,223 probably benign Het
Csmd3 T C 15: 48,457,662 I251V probably benign Het
Csnk1g3 G A 18: 53,917,028 V115M probably damaging Het
Cst7 A T 2: 150,570,519 M1L probably benign Het
Cyp4f17 A T 17: 32,527,843 D373V probably damaging Het
Dclk2 G A 3: 86,906,004 R212W probably damaging Het
Dhrs7b T G 11: 60,830,746 probably benign Het
Dhx58 T A 11: 100,702,251 H210L probably benign Het
Dnah9 T C 11: 65,841,333 Y4249C probably damaging Het
Eif5b T A 1: 38,048,893 L990H probably damaging Het
Faap24 T C 7: 35,394,963 probably benign Het
Fryl T A 5: 73,124,734 H174L probably benign Het
Gabrr1 T C 4: 33,132,696 W15R probably benign Het
Gif A T 19: 11,752,294 I206F possibly damaging Het
Gm15446 T C 5: 109,943,481 V533A probably benign Het
Gm6760 T A X: 64,151,653 K63* probably null Het
Gne C T 4: 44,042,244 E444K possibly damaging Het
Gpr173 T A X: 152,347,040 M146L possibly damaging Het
Hira C T 16: 18,935,047 S547L probably benign Het
Hnf1b A G 11: 83,863,984 H161R probably benign Het
Hnrnpm T A 17: 33,658,390 N53I probably damaging Het
Hs3st5 A T 10: 36,832,588 I40F probably benign Het
Hydin C T 8: 110,549,798 probably benign Het
Ift172 A G 5: 31,254,313 I1607T probably damaging Het
Igfn1 T C 1: 135,959,901 Q2475R probably damaging Het
Il6st T C 13: 112,504,272 S800P possibly damaging Het
Iqub G A 6: 24,501,261 probably benign Het
Itgb1 A T 8: 128,722,372 probably benign Het
Kctd21 G A 7: 97,347,601 E94K probably benign Het
Kir3dl2 A G X: 136,453,511 V233A possibly damaging Het
Klra2 A T 6: 131,220,224 C271S probably damaging Het
Lacc1 A T 14: 77,029,621 C401S probably damaging Het
Lmna T C 3: 88,482,578 E580G probably damaging Het
Matn2 A G 15: 34,345,150 Y101C probably damaging Het
Mrps16 G A 14: 20,391,389 R116* probably null Het
Ndrg2 G T 14: 51,906,217 R333S probably damaging Het
Nf2 A G 11: 4,782,194 I507T possibly damaging Het
Nktr A G 9: 121,749,290 probably benign Het
Nkx3-1 G A 14: 69,191,006 probably benign Het
Npat T C 9: 53,556,481 probably null Het
Nrxn1 T C 17: 90,565,373 N1047S probably damaging Het
Nup210 A T 6: 91,026,929 I1402N possibly damaging Het
Olfr1168 G T 2: 88,185,280 M134I possibly damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdcl2 C T 5: 76,312,481 S182N probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plekha8 A G 6: 54,629,820 K367E probably damaging Het
Pola1 A G X: 93,488,087 probably benign Het
Ppm1d C T 11: 85,345,877 T494I probably benign Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prl6a1 A T 13: 27,314,194 probably benign Het
Ptprg T A 14: 12,154,131 S617R probably benign Het
R3hdm2 G A 10: 127,444,444 G45D probably damaging Het
Rev1 T A 1: 38,059,123 R780W probably null Het
Rnf139 T A 15: 58,899,827 F567Y probably damaging Het
Scarf1 T C 11: 75,514,348 V71A probably damaging Het
Shtn1 A G 19: 58,999,940 S438P probably damaging Het
Slc30a3 T A 5: 31,088,723 H221L probably benign Het
Smo A C 6: 29,753,604 I160L possibly damaging Het
Snapc5 A T 9: 64,179,300 probably benign Het
Snf8 G T 11: 96,034,973 probably benign Het
Spata31d1a T C 13: 59,702,431 S628G probably benign Het
Sphkap A T 1: 83,280,424 D199E probably damaging Het
Stxbp5l T C 16: 37,204,521 T572A possibly damaging Het
Thada C A 17: 84,416,303 V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 Q735R probably benign Het
Tmem29 C T X: 150,398,364 A144T probably benign Het
Trim24 G A 6: 37,871,234 E42K probably benign Het
Trnt1 T A 6: 106,777,908 probably benign Het
Ttbk2 A T 2: 120,773,872 M215K probably damaging Het
Ttc8 C T 12: 98,943,459 probably benign Het
Ube3c A G 5: 29,590,928 Y105C probably damaging Het
Unc13c A G 9: 73,530,983 probably benign Het
Usp36 A G 11: 118,263,028 probably benign Het
Vmn2r102 T C 17: 19,678,844 S483P possibly damaging Het
Wdr95 A G 5: 149,588,130 T432A probably damaging Het
Wnk1 G T 6: 119,926,683 P2523H probably damaging Het
Xpo4 A G 14: 57,638,208 probably benign Het
Zar1 G T 5: 72,580,543 P71Q probably damaging Het
Zbtb41 T C 1: 139,423,610 Y154H probably benign Het
Zer1 G T 2: 30,104,797 probably benign Het
Zfp454 A G 11: 50,874,185 F140S probably benign Het
Other mutations in Pla2g4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Pla2g4a APN 1 149886203 missense probably benign 0.08
IGL00763:Pla2g4a APN 1 149851325 missense probably damaging 1.00
IGL01548:Pla2g4a APN 1 149932656 critical splice donor site probably null
IGL01683:Pla2g4a APN 1 149857654 missense probably benign 0.05
IGL01903:Pla2g4a APN 1 149840619 missense possibly damaging 0.51
IGL02049:Pla2g4a APN 1 149861096 missense probably benign 0.12
IGL02103:Pla2g4a APN 1 149901199 missense probably damaging 0.99
IGL03132:Pla2g4a APN 1 149902284 splice site probably benign
IGL03299:Pla2g4a APN 1 149851367 missense probably damaging 1.00
IGL03302:Pla2g4a APN 1 149864947 missense probably benign 0.00
R0110:Pla2g4a UTSW 1 149840647 missense possibly damaging 0.67
R0469:Pla2g4a UTSW 1 149840647 missense possibly damaging 0.67
R0488:Pla2g4a UTSW 1 149871445 missense probably damaging 1.00
R1468:Pla2g4a UTSW 1 149887593 splice site probably benign
R1470:Pla2g4a UTSW 1 149840720 missense probably damaging 1.00
R1470:Pla2g4a UTSW 1 149840720 missense probably damaging 1.00
R1521:Pla2g4a UTSW 1 149857686 critical splice acceptor site probably null
R1718:Pla2g4a UTSW 1 149871523 splice site probably benign
R1778:Pla2g4a UTSW 1 149902445 splice site probably benign
R1967:Pla2g4a UTSW 1 149922081 missense probably damaging 1.00
R2063:Pla2g4a UTSW 1 149840676 missense possibly damaging 0.94
R2291:Pla2g4a UTSW 1 149901189 missense probably damaging 1.00
R3855:Pla2g4a UTSW 1 149830177 missense possibly damaging 0.86
R4512:Pla2g4a UTSW 1 149861051 splice site probably null
R4568:Pla2g4a UTSW 1 149842226 missense probably benign 0.43
R5266:Pla2g4a UTSW 1 149865167 missense possibly damaging 0.79
R5855:Pla2g4a UTSW 1 149880063 missense probably damaging 0.99
R5897:Pla2g4a UTSW 1 149865148 missense probably damaging 0.99
R6012:Pla2g4a UTSW 1 149932677 missense possibly damaging 0.55
R6193:Pla2g4a UTSW 1 149902430 missense probably damaging 1.00
R6246:Pla2g4a UTSW 1 149872587 missense probably damaging 1.00
R6248:Pla2g4a UTSW 1 149872587 missense probably damaging 1.00
R6258:Pla2g4a UTSW 1 149857487 missense probably benign 0.00
R6260:Pla2g4a UTSW 1 149857487 missense probably benign 0.00
R6293:Pla2g4a UTSW 1 149880047 missense probably damaging 0.98
R6310:Pla2g4a UTSW 1 149842226 missense possibly damaging 0.88
R6490:Pla2g4a UTSW 1 149851335 nonsense probably null
R6502:Pla2g4a UTSW 1 149872616 nonsense probably null
R6614:Pla2g4a UTSW 1 149842235 missense probably benign 0.07
R6671:Pla2g4a UTSW 1 149887631 missense probably benign
R6745:Pla2g4a UTSW 1 149886230 missense probably benign 0.07
R6880:Pla2g4a UTSW 1 149851451 missense possibly damaging 0.90
R7058:Pla2g4a UTSW 1 149851352 missense probably damaging 1.00
X0021:Pla2g4a UTSW 1 149864926 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGGTCACCTCAGAGCCATATCTGTC -3'
(R):5'- ACGGAAGCTGGGTATCTTCCCAAC -3'

Sequencing Primer
(F):5'- CAGAGCCATATCTGTCTTCTTAATG -3'
(R):5'- AATCACAGGCTTTCTGGTGATTC -3'
Posted On2013-07-11