Incidental Mutation 'R6950:Oxr1'
ID541234
Institutional Source Beutler Lab
Gene Symbol Oxr1
Ensembl Gene ENSMUSG00000022307
Gene Nameoxidation resistance 1
SynonymsC7B, 2210416C20Rik, C7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6950 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location41447482-41861048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 41820555 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 439 (A439E)
Ref Sequence ENSEMBL: ENSMUSP00000155161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022918] [ENSMUST00000090095] [ENSMUST00000090096] [ENSMUST00000110297] [ENSMUST00000170127] [ENSMUST00000179393] [ENSMUST00000229511] [ENSMUST00000229769] [ENSMUST00000230203] [ENSMUST00000230778]
Predicted Effect probably benign
Transcript: ENSMUST00000022918
AA Change: A439E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022918
Gene: ENSMUSG00000022307
AA Change: A439E

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 616 778 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090095
AA Change: A439E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087553
Gene: ENSMUSG00000022307
AA Change: A439E

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 589 751 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090096
AA Change: A439E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087554
Gene: ENSMUSG00000022307
AA Change: A439E

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 589 751 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110297
AA Change: A527E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105926
Gene: ENSMUSG00000022307
AA Change: A527E

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
LysM 99 142 2.48e-9 SMART
low complexity region 201 208 N/A INTRINSIC
low complexity region 628 645 N/A INTRINSIC
TLDc 704 866 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170127
AA Change: A520E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126266
Gene: ENSMUSG00000022307
AA Change: A520E

DomainStartEndE-ValueType
LysM 92 135 2.48e-9 SMART
low complexity region 194 201 N/A INTRINSIC
low complexity region 621 638 N/A INTRINSIC
TLDc 670 832 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179393
AA Change: A439E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136923
Gene: ENSMUSG00000022307
AA Change: A439E

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 589 751 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229511
Predicted Effect probably benign
Transcript: ENSMUST00000229769
Predicted Effect probably benign
Transcript: ENSMUST00000230203
AA Change: A527E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000230778
AA Change: A439E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.1188 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in progressive cerebellar neurodegeneration and ataxia, increased apoptosis in the cerebellar granule cell layer, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,411,616 V404D probably damaging Het
Adcy2 A G 13: 68,888,065 M159T possibly damaging Het
Agtpbp1 T C 13: 59,450,266 K674R probably benign Het
Atxn7 C A 14: 14,095,511 P403H probably damaging Het
Cav3 C T 6: 112,472,210 T63I probably damaging Het
Ccr6 T C 17: 8,257,066 *368Q probably null Het
Cdh8 A T 8: 99,030,763 N734K probably benign Het
Ces5a G T 8: 93,530,774 N134K probably benign Het
Cisd3 T G 11: 97,686,160 probably null Het
Cyp4f39 T G 17: 32,492,306 C476G probably damaging Het
Dffb A T 4: 153,970,092 M180K probably benign Het
Dock4 A G 12: 40,733,314 E749G possibly damaging Het
Eogt A G 6: 97,134,382 F173L possibly damaging Het
Ephb1 T A 9: 102,194,909 T224S probably benign Het
Fam114a1 A T 5: 64,979,979 E88D possibly damaging Het
Fam84b T C 15: 60,823,714 D61G probably benign Het
Fbn2 A C 18: 58,035,921 M2262R probably null Het
Fsip2 A G 2: 82,985,988 I4022V probably benign Het
Gapvd1 A G 2: 34,684,245 V1301A probably benign Het
Gch1 A T 14: 47,189,266 M1K probably null Het
Hes1 T C 16: 30,067,271 F231S probably damaging Het
Hoxb2 A G 11: 96,351,901 T31A probably benign Het
Ifngr1 T A 10: 19,607,293 V265D probably damaging Het
Ifnl3 A T 7: 28,523,007 I58F probably benign Het
Igf2r T C 17: 12,718,718 T561A probably benign Het
Igfbpl1 T A 4: 45,815,494 H214L probably damaging Het
Irf8 A G 8: 120,755,125 T318A probably benign Het
Kmt2d T C 15: 98,840,020 probably benign Het
Lrrc36 G T 8: 105,425,389 probably null Het
Msl2 C T 9: 101,101,975 P516L possibly damaging Het
Naaladl1 A T 19: 6,105,981 I62F probably damaging Het
Neto2 G T 8: 85,670,443 P60Q probably damaging Het
Nipsnap3b A T 4: 53,015,136 H61L possibly damaging Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nutm1 T A 2: 112,248,559 T1004S probably benign Het
Olfr1251 T A 2: 89,667,551 I112F probably benign Het
Olfr1427 A G 19: 12,099,390 V83A probably benign Het
Olfr895 A T 9: 38,268,546 N3I probably damaging Het
Phf14 A T 6: 12,006,855 K835N probably damaging Het
Prkdc T A 16: 15,815,986 V3518E probably damaging Het
Ptpru T A 4: 131,776,352 E1132D probably damaging Het
Rapgef6 T A 11: 54,676,380 M1129K probably benign Het
Rgmb T C 17: 15,807,786 K224E probably damaging Het
Ryr3 T C 2: 112,686,825 I3318V possibly damaging Het
Slc9a4 A G 1: 40,602,885 Y338C probably damaging Het
Smg5 T C 3: 88,349,269 probably null Het
Tenm3 A T 8: 48,240,479 Y1789* probably null Het
Tgm7 T C 2: 121,093,647 E598G probably damaging Het
Tiam1 C T 16: 89,860,204 probably null Het
Tmem175 A G 5: 108,643,082 N166S probably benign Het
Trp73 G T 4: 154,062,053 N368K probably benign Het
Trpc3 C T 3: 36,638,590 R751H probably damaging Het
Trpm4 C A 7: 45,319,280 A410S probably damaging Het
Ube2t T G 1: 134,971,357 probably null Het
Vmn2r114 C T 17: 23,310,163 A322T probably benign Het
Xylt2 C T 11: 94,667,629 R567H probably benign Het
Zfp119b T C 17: 55,939,137 K318E probably damaging Het
Zfp626 T G 7: 27,818,914 L440R probably damaging Het
Zfp850 A G 7: 27,990,514 S90P possibly damaging Het
Other mutations in Oxr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Oxr1 APN 15 41820143 missense possibly damaging 0.46
IGL02243:Oxr1 APN 15 41535701 utr 5 prime probably benign
IGL02711:Oxr1 APN 15 41653671 splice site probably benign
IGL02810:Oxr1 APN 15 41813583 missense probably benign 0.26
IGL02850:Oxr1 APN 15 41854933 missense probably damaging 1.00
IGL03028:Oxr1 APN 15 41817163 missense probably damaging 1.00
IGL03126:Oxr1 APN 15 41820249 missense possibly damaging 0.66
PIT4378001:Oxr1 UTSW 15 41801582 missense probably benign 0.01
R0004:Oxr1 UTSW 15 41820540 missense possibly damaging 0.64
R0276:Oxr1 UTSW 15 41820062 missense probably damaging 1.00
R0394:Oxr1 UTSW 15 41817197 missense probably damaging 1.00
R1513:Oxr1 UTSW 15 41797474 missense probably damaging 1.00
R1742:Oxr1 UTSW 15 41850559 missense probably damaging 1.00
R2145:Oxr1 UTSW 15 41819944 missense probably damaging 1.00
R2924:Oxr1 UTSW 15 41825957 missense probably benign 0.01
R3732:Oxr1 UTSW 15 41848701 missense probably damaging 1.00
R4537:Oxr1 UTSW 15 41820519 missense possibly damaging 0.67
R4722:Oxr1 UTSW 15 41813649 missense probably damaging 1.00
R4935:Oxr1 UTSW 15 41813584 missense probably benign 0.00
R5417:Oxr1 UTSW 15 41820371 missense probably benign 0.00
R6029:Oxr1 UTSW 15 41825901 missense probably damaging 1.00
R6187:Oxr1 UTSW 15 41825919 missense probably damaging 1.00
R6864:Oxr1 UTSW 15 41823387 missense probably damaging 1.00
R7225:Oxr1 UTSW 15 41813608 missense not run
R7288:Oxr1 UTSW 15 41813608 missense not run
R7305:Oxr1 UTSW 15 41813608 missense not run
X0025:Oxr1 UTSW 15 41820452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTCACTGCAGCAAGAGGC -3'
(R):5'- GACATGTTCCCGGAATAAAGC -3'

Sequencing Primer
(F):5'- AGACAGTGTATCTTCTGGAGAAAC -3'
(R):5'- TGTTCCCGGAATAAAGCCAGTC -3'
Posted On2018-11-28