Incidental Mutation 'R0606:Cst7'
ID54128
Institutional Source Beutler Lab
Gene Symbol Cst7
Ensembl Gene ENSMUSG00000068129
Gene Namecystatin F (leukocystatin)
Synonymscystatin-like metastasis-associated protein, CMAP, Leukocystatin
MMRRC Submission 038795-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0606 (G1)
Quality Score138
Status Validated
Chromosome2
Chromosomal Location150570415-150578944 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 150570519 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000086606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089200]
Predicted Effect probably benign
Transcript: ENSMUST00000089200
AA Change: M1L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000086606
Gene: ENSMUSG00000068129
AA Change: M1L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 33 144 1.04e-22 SMART
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. This gene encodes a glycosylated cysteine protease inhibitor with a putative role in immune regulation through inhibition of a unique target in the hematopoietic system. Expression of the protein has been observed in various human cancer cell lines established from malignant tumors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,259,089 Y128H probably damaging Het
Actl9 T C 17: 33,433,598 Y211H probably damaging Het
Actn1 A T 12: 80,174,647 probably benign Het
Adtrp A G 13: 41,767,405 F197L probably damaging Het
Ankrd11 G A 8: 122,892,832 T1406I probably benign Het
Arhgap24 A T 5: 102,897,220 R620W probably damaging Het
Atg13 A G 2: 91,682,073 Y284H probably benign Het
Atrn A G 2: 130,906,856 E99G possibly damaging Het
Cage1 A T 13: 38,016,494 probably benign Het
Ccr3 T A 9: 124,028,802 M58K probably benign Het
Cdk18 G T 1: 132,117,617 probably benign Het
Chst5 A G 8: 111,890,919 V23A probably benign Het
Col4a3 T C 1: 82,672,586 probably benign Het
Col4a6 A G X: 141,192,223 probably benign Het
Csmd3 T C 15: 48,457,662 I251V probably benign Het
Csnk1g3 G A 18: 53,917,028 V115M probably damaging Het
Cyp4f17 A T 17: 32,527,843 D373V probably damaging Het
Dclk2 G A 3: 86,906,004 R212W probably damaging Het
Dhrs7b T G 11: 60,830,746 probably benign Het
Dhx58 T A 11: 100,702,251 H210L probably benign Het
Dnah9 T C 11: 65,841,333 Y4249C probably damaging Het
Eif5b T A 1: 38,048,893 L990H probably damaging Het
Faap24 T C 7: 35,394,963 probably benign Het
Fryl T A 5: 73,124,734 H174L probably benign Het
Gabrr1 T C 4: 33,132,696 W15R probably benign Het
Gif A T 19: 11,752,294 I206F possibly damaging Het
Gm15446 T C 5: 109,943,481 V533A probably benign Het
Gm6760 T A X: 64,151,653 K63* probably null Het
Gne C T 4: 44,042,244 E444K possibly damaging Het
Gpr173 T A X: 152,347,040 M146L possibly damaging Het
Hira C T 16: 18,935,047 S547L probably benign Het
Hnf1b A G 11: 83,863,984 H161R probably benign Het
Hnrnpm T A 17: 33,658,390 N53I probably damaging Het
Hs3st5 A T 10: 36,832,588 I40F probably benign Het
Hydin C T 8: 110,549,798 probably benign Het
Ift172 A G 5: 31,254,313 I1607T probably damaging Het
Igfn1 T C 1: 135,959,901 Q2475R probably damaging Het
Il6st T C 13: 112,504,272 S800P possibly damaging Het
Iqub G A 6: 24,501,261 probably benign Het
Itgb1 A T 8: 128,722,372 probably benign Het
Kctd21 G A 7: 97,347,601 E94K probably benign Het
Kir3dl2 A G X: 136,453,511 V233A possibly damaging Het
Klra2 A T 6: 131,220,224 C271S probably damaging Het
Lacc1 A T 14: 77,029,621 C401S probably damaging Het
Lmna T C 3: 88,482,578 E580G probably damaging Het
Matn2 A G 15: 34,345,150 Y101C probably damaging Het
Mrps16 G A 14: 20,391,389 R116* probably null Het
Ndrg2 G T 14: 51,906,217 R333S probably damaging Het
Nf2 A G 11: 4,782,194 I507T possibly damaging Het
Nktr A G 9: 121,749,290 probably benign Het
Nkx3-1 G A 14: 69,191,006 probably benign Het
Npat T C 9: 53,556,481 probably null Het
Nrxn1 T C 17: 90,565,373 N1047S probably damaging Het
Nup210 A T 6: 91,026,929 I1402N possibly damaging Het
Olfr1168 G T 2: 88,185,280 M134I possibly damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdcl2 C T 5: 76,312,481 S182N probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pla2g4a A G 1: 149,840,704 F669L probably benign Het
Plekha8 A G 6: 54,629,820 K367E probably damaging Het
Pola1 A G X: 93,488,087 probably benign Het
Ppm1d C T 11: 85,345,877 T494I probably benign Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prl6a1 A T 13: 27,314,194 probably benign Het
Ptprg T A 14: 12,154,131 S617R probably benign Het
R3hdm2 G A 10: 127,444,444 G45D probably damaging Het
Rev1 T A 1: 38,059,123 R780W probably null Het
Rnf139 T A 15: 58,899,827 F567Y probably damaging Het
Scarf1 T C 11: 75,514,348 V71A probably damaging Het
Shtn1 A G 19: 58,999,940 S438P probably damaging Het
Slc30a3 T A 5: 31,088,723 H221L probably benign Het
Smo A C 6: 29,753,604 I160L possibly damaging Het
Snapc5 A T 9: 64,179,300 probably benign Het
Snf8 G T 11: 96,034,973 probably benign Het
Spata31d1a T C 13: 59,702,431 S628G probably benign Het
Sphkap A T 1: 83,280,424 D199E probably damaging Het
Stxbp5l T C 16: 37,204,521 T572A possibly damaging Het
Thada C A 17: 84,416,303 V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 Q735R probably benign Het
Tmem29 C T X: 150,398,364 A144T probably benign Het
Trim24 G A 6: 37,871,234 E42K probably benign Het
Trnt1 T A 6: 106,777,908 probably benign Het
Ttbk2 A T 2: 120,773,872 M215K probably damaging Het
Ttc8 C T 12: 98,943,459 probably benign Het
Ube3c A G 5: 29,590,928 Y105C probably damaging Het
Unc13c A G 9: 73,530,983 probably benign Het
Usp36 A G 11: 118,263,028 probably benign Het
Vmn2r102 T C 17: 19,678,844 S483P possibly damaging Het
Wdr95 A G 5: 149,588,130 T432A probably damaging Het
Wnk1 G T 6: 119,926,683 P2523H probably damaging Het
Xpo4 A G 14: 57,638,208 probably benign Het
Zar1 G T 5: 72,580,543 P71Q probably damaging Het
Zbtb41 T C 1: 139,423,610 Y154H probably benign Het
Zer1 G T 2: 30,104,797 probably benign Het
Zfp454 A G 11: 50,874,185 F140S probably benign Het
Other mutations in Cst7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0166:Cst7 UTSW 2 150575727 missense probably benign 0.01
R0530:Cst7 UTSW 2 150570515 start gained probably benign
R0620:Cst7 UTSW 2 150575886 splice site probably benign
R1856:Cst7 UTSW 2 150577708 missense probably damaging 1.00
R5556:Cst7 UTSW 2 150570568 missense probably benign
R7315:Cst7 UTSW 2 150570583 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCCCCAAGTCCTGAAGATGAAG -3'
(R):5'- TCAGCTTTCCAACACAGGCGAC -3'

Sequencing Primer
(F):5'- TGTACTTGCCGAGCACTTGG -3'
(R):5'- CTCAGGGTTCCAAGAGTGTC -3'
Posted On2013-07-11