Incidental Mutation 'R6953:Tars2'
ID541301
Institutional Source Beutler Lab
Gene Symbol Tars2
Ensembl Gene ENSMUSG00000028107
Gene Namethreonyl-tRNA synthetase 2, mitochondrial (putative)
SynonymsTarsl1, 2610024N01Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027931.3, NM_001163617.1, NM_001163618.1, NM_001163619.1; Ensembl: ENSMUST00000029752, ENSMUST00000074339 , ENSMUST00000098857, ENSMUST00000163530

Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6953 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95739976-95760206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95753114 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 99 (T99A)
Ref Sequence ENSEMBL: ENSMUSP00000096456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029752] [ENSMUST00000074339] [ENSMUST00000098857] [ENSMUST00000163530] [ENSMUST00000195929] [ENSMUST00000196077] [ENSMUST00000196868] [ENSMUST00000197501] [ENSMUST00000197720] [ENSMUST00000198289] [ENSMUST00000199464] [ENSMUST00000199570]
Predicted Effect probably benign
Transcript: ENSMUST00000029752
AA Change: T99A

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029752
Gene: ENSMUSG00000028107
AA Change: T99A

DomainStartEndE-ValueType
Pfam:TGS 66 126 5.6e-14 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 400 608 2.4e-32 PFAM
Pfam:HGTP_anticodon 620 711 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074339
AA Change: T99A

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073946
Gene: ENSMUSG00000028107
AA Change: T99A

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.3e-15 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 336 519 2.8e-39 PFAM
Pfam:HGTP_anticodon 594 685 5.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098857
AA Change: T99A

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096456
Gene: ENSMUSG00000028107
AA Change: T99A

DomainStartEndE-ValueType
Pfam:TGS 66 126 6.7e-16 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
SCOP:d1atia2 332 417 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163530
AA Change: T99A

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130269
Gene: ENSMUSG00000028107
AA Change: T99A

DomainStartEndE-ValueType
Pfam:TGS 66 126 2.6e-15 PFAM
tRNA_SAD 152 201 1.15e-10 SMART
Pfam:tRNA-synt_2b 255 438 8.6e-40 PFAM
Pfam:HGTP_anticodon 539 630 1.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195929
SMART Domains Protein: ENSMUSP00000143757
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:tRNA_SAD 1 28 3.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196077
AA Change: T98A

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143722
Gene: ENSMUSG00000028107
AA Change: T98A

DomainStartEndE-ValueType
Pfam:TGS 65 125 5e-13 PFAM
tRNA_SAD 232 264 7.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196868
Predicted Effect probably benign
Transcript: ENSMUST00000197501
Predicted Effect probably benign
Transcript: ENSMUST00000197720
Predicted Effect probably benign
Transcript: ENSMUST00000198289
SMART Domains Protein: ENSMUSP00000143271
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
tRNA_SAD 2 43 2.6e-8 SMART
Pfam:tRNA-synt_2b 97 142 6.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199464
AA Change: T99A

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143328
Gene: ENSMUSG00000028107
AA Change: T99A

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199570
AA Change: T99A

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143038
Gene: ENSMUSG00000028107
AA Change: T99A

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.5e-13 PFAM
tRNA_SAD 152 201 8.5e-15 SMART
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-II aminoacyl-tRNA synthetase family. The encoded protein is a mitochondrial aminoacyl-tRNA synthetase. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 4. [provided by RefSeq, Dec 2012]
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C A 15: 58,028,827 S128I probably damaging Het
Aadacl2 A C 3: 60,024,760 H232P possibly damaging Het
Abcc3 A G 11: 94,374,835 Y125H probably benign Het
Adgrb3 A G 1: 25,826,511 S84P probably damaging Het
Adgrd1 A T 5: 129,115,078 K71* probably null Het
Ap2m1 T A 16: 20,542,718 W381R probably damaging Het
Ascc3 A G 10: 50,645,666 I426V probably benign Het
BC024063 T A 10: 82,107,899 D31E possibly damaging Het
C3ar1 G A 6: 122,850,632 H209Y possibly damaging Het
Ccp110 T C 7: 118,722,421 V433A possibly damaging Het
Cfap54 A G 10: 92,994,678 S1199P probably benign Het
Cyp24a1 T G 2: 170,487,946 D362A probably benign Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnmt1 G T 9: 20,918,526 Q633K probably benign Het
Ercc4 T A 16: 13,130,686 V499D probably damaging Het
Ier3ip1 C G 18: 76,939,613 P46R probably damaging Het
Ifi211 T C 1: 173,906,266 T110A probably damaging Het
Isoc1 A G 18: 58,671,302 D134G possibly damaging Het
Kif26b A G 1: 178,874,072 D672G possibly damaging Het
Klhl33 T A 14: 50,891,516 D752V possibly damaging Het
Lcn4 A G 2: 26,669,355 Y133H probably benign Het
Mrs2 C A 13: 25,001,788 V134L probably benign Het
Muc16 T C 9: 18,640,529 T4823A probably benign Het
Ogfod3 A G 11: 121,202,998 I62T probably benign Het
Olfr1380 A G 11: 49,564,290 Y123C probably damaging Het
Olfr165 C T 16: 19,407,528 V164I probably benign Het
Olfr773 A T 10: 129,186,605 M272K probably benign Het
Olfr869 A T 9: 20,138,003 I296L probably benign Het
Papln G A 12: 83,781,885 W788* probably null Het
Pcdhac2 A G 18: 37,144,426 Q153R probably benign Het
Pcdhgb2 C T 18: 37,690,754 T266I possibly damaging Het
Pcdhgc5 C A 18: 37,820,461 R263S possibly damaging Het
Phactr4 T C 4: 132,377,351 T185A possibly damaging Het
Plcxd2 T C 16: 45,980,519 D114G probably damaging Het
Polr2a A T 11: 69,741,711 I987N probably damaging Het
Prl3d3 A G 13: 27,161,046 M134V probably benign Het
Pum2 T A 12: 8,728,779 probably null Het
Racgap1 T C 15: 99,626,329 E399G probably damaging Het
Sbspon A T 1: 15,860,295 S156T probably damaging Het
Scn1a T C 2: 66,319,469 T927A probably damaging Het
Sec23ip C A 7: 128,752,796 S78* probably null Het
Serpina1d G A 12: 103,767,730 T105I probably benign Het
Slc25a21 T A 12: 57,159,169 N26Y probably benign Het
Smim20 T A 5: 53,277,916 D64E probably damaging Het
Spag17 T G 3: 100,034,975 I772S possibly damaging Het
Tdrd1 C T 19: 56,831,371 T101I probably damaging Het
Tldc2 T G 2: 157,089,278 probably null Het
Ttn A G 2: 76,771,585 Y10251H probably damaging Het
Ush2a A G 1: 188,263,145 R38G possibly damaging Het
Usp19 T C 9: 108,498,931 L991P possibly damaging Het
Vmn2r109 G A 17: 20,540,711 P795S possibly damaging Het
Vmn2r26 T C 6: 124,039,782 Y402H probably benign Het
Vmn2r-ps117 T G 17: 18,824,833 I504R probably benign Het
Zfp551 A T 7: 12,416,788 C231* probably null Het
Zfp607a T A 7: 27,878,365 C287S possibly damaging Het
Zim1 T A 7: 6,687,707 T40S unknown Het
Other mutations in Tars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Tars2 APN 3 95740278 missense probably damaging 1.00
IGL02523:Tars2 APN 3 95741393 missense probably damaging 1.00
IGL02709:Tars2 APN 3 95742071 splice site probably benign
IGL03286:Tars2 APN 3 95754755 splice site probably benign
IGL03348:Tars2 APN 3 95740268 unclassified probably null
B6584:Tars2 UTSW 3 95742150 unclassified probably null
R0548:Tars2 UTSW 3 95742659 missense probably damaging 1.00
R0657:Tars2 UTSW 3 95748557 missense probably benign 0.00
R1955:Tars2 UTSW 3 95747454 missense probably damaging 1.00
R2070:Tars2 UTSW 3 95747638 missense probably damaging 1.00
R2071:Tars2 UTSW 3 95747638 missense probably damaging 1.00
R3025:Tars2 UTSW 3 95747640 missense possibly damaging 0.71
R3962:Tars2 UTSW 3 95754756 critical splice donor site probably null
R4676:Tars2 UTSW 3 95753091 missense probably damaging 1.00
R4775:Tars2 UTSW 3 95746647 missense probably damaging 1.00
R5208:Tars2 UTSW 3 95747593 missense probably damaging 1.00
R5512:Tars2 UTSW 3 95750416 missense probably damaging 1.00
R5894:Tars2 UTSW 3 95747652 unclassified probably null
R5965:Tars2 UTSW 3 95748152 splice site probably null
R6381:Tars2 UTSW 3 95754487 nonsense probably null
R7042:Tars2 UTSW 3 95750745 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCCACTTTTGAATTGAGAAAGTG -3'
(R):5'- AGAATTTCTGCCCTTCCCAATG -3'

Sequencing Primer
(F):5'- AGCAAAAGAACAATTACATTTTCCTG -3'
(R):5'- GCCCTTCCCAATGTAGTGGATAC -3'
Posted On2018-11-28