Incidental Mutation 'R6953:Sec23ip'
ID541312
Institutional Source Beutler Lab
Gene Symbol Sec23ip
Ensembl Gene ENSMUSG00000055319
Gene NameSec23 interacting protein
SynonymsD7Ertd373e, p125
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.664) question?
Stock #R6953 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location128744943-128784836 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 128752796 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 78 (S78*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042942] [ENSMUST00000206986]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042942
AA Change: Q259K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035610
Gene: ENSMUSG00000055319
AA Change: Q259K

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 41 51 N/A INTRINSIC
low complexity region 79 88 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 222 230 N/A INTRINSIC
Blast:DDHD 513 585 8e-33 BLAST
SAM 637 702 2.18e-9 SMART
DDHD 777 987 1.33e-74 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205856
AA Change: S78*
Predicted Effect probably benign
Transcript: ENSMUST00000206986
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Male mice homozygous for a null allele display reduced fertility with globozoospermia and impaired fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C A 15: 58,028,827 S128I probably damaging Het
Aadacl2 A C 3: 60,024,760 H232P possibly damaging Het
Abcc3 A G 11: 94,374,835 Y125H probably benign Het
Adgrb3 A G 1: 25,826,511 S84P probably damaging Het
Adgrd1 A T 5: 129,115,078 K71* probably null Het
Ap2m1 T A 16: 20,542,718 W381R probably damaging Het
Ascc3 A G 10: 50,645,666 I426V probably benign Het
BC024063 T A 10: 82,107,899 D31E possibly damaging Het
C3ar1 G A 6: 122,850,632 H209Y possibly damaging Het
Ccp110 T C 7: 118,722,421 V433A possibly damaging Het
Cfap54 A G 10: 92,994,678 S1199P probably benign Het
Cyp24a1 T G 2: 170,487,946 D362A probably benign Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnmt1 G T 9: 20,918,526 Q633K probably benign Het
Ercc4 T A 16: 13,130,686 V499D probably damaging Het
Ier3ip1 C G 18: 76,939,613 P46R probably damaging Het
Ifi211 T C 1: 173,906,266 T110A probably damaging Het
Isoc1 A G 18: 58,671,302 D134G possibly damaging Het
Kif26b A G 1: 178,874,072 D672G possibly damaging Het
Klhl33 T A 14: 50,891,516 D752V possibly damaging Het
Lcn4 A G 2: 26,669,355 Y133H probably benign Het
Mrs2 C A 13: 25,001,788 V134L probably benign Het
Muc16 T C 9: 18,640,529 T4823A probably benign Het
Ogfod3 A G 11: 121,202,998 I62T probably benign Het
Olfr1380 A G 11: 49,564,290 Y123C probably damaging Het
Olfr165 C T 16: 19,407,528 V164I probably benign Het
Olfr773 A T 10: 129,186,605 M272K probably benign Het
Olfr869 A T 9: 20,138,003 I296L probably benign Het
Papln G A 12: 83,781,885 W788* probably null Het
Pcdhac2 A G 18: 37,144,426 Q153R probably benign Het
Pcdhgb2 C T 18: 37,690,754 T266I possibly damaging Het
Pcdhgc5 C A 18: 37,820,461 R263S possibly damaging Het
Phactr4 T C 4: 132,377,351 T185A possibly damaging Het
Plcxd2 T C 16: 45,980,519 D114G probably damaging Het
Polr2a A T 11: 69,741,711 I987N probably damaging Het
Prl3d3 A G 13: 27,161,046 M134V probably benign Het
Pum2 T A 12: 8,728,779 probably null Het
Racgap1 T C 15: 99,626,329 E399G probably damaging Het
Sbspon A T 1: 15,860,295 S156T probably damaging Het
Scn1a T C 2: 66,319,469 T927A probably damaging Het
Serpina1d G A 12: 103,767,730 T105I probably benign Het
Slc25a21 T A 12: 57,159,169 N26Y probably benign Het
Smim20 T A 5: 53,277,916 D64E probably damaging Het
Spag17 T G 3: 100,034,975 I772S possibly damaging Het
Tars2 T C 3: 95,753,114 T99A possibly damaging Het
Tdrd1 C T 19: 56,831,371 T101I probably damaging Het
Tldc2 T G 2: 157,089,278 probably null Het
Ttn A G 2: 76,771,585 Y10251H probably damaging Het
Ush2a A G 1: 188,263,145 R38G possibly damaging Het
Usp19 T C 9: 108,498,931 L991P possibly damaging Het
Vmn2r109 G A 17: 20,540,711 P795S possibly damaging Het
Vmn2r26 T C 6: 124,039,782 Y402H probably benign Het
Vmn2r-ps117 T G 17: 18,824,833 I504R probably benign Het
Zfp551 A T 7: 12,416,788 C231* probably null Het
Zfp607a T A 7: 27,878,365 C287S possibly damaging Het
Zim1 T A 7: 6,687,707 T40S unknown Het
Other mutations in Sec23ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Sec23ip APN 7 128767609 missense probably damaging 1.00
IGL01347:Sec23ip APN 7 128762405 missense probably benign 0.08
IGL01358:Sec23ip APN 7 128752797 missense possibly damaging 0.68
IGL01656:Sec23ip APN 7 128750245 missense probably damaging 1.00
IGL01835:Sec23ip APN 7 128755311 splice site probably null
IGL02233:Sec23ip APN 7 128779179 missense probably damaging 1.00
IGL02499:Sec23ip APN 7 128776916 missense probably damaging 1.00
IGL03381:Sec23ip APN 7 128750305 missense probably damaging 0.97
R0053:Sec23ip UTSW 7 128745167 missense probably damaging 1.00
R0147:Sec23ip UTSW 7 128779051 splice site probably benign
R0360:Sec23ip UTSW 7 128761405 splice site probably benign
R1427:Sec23ip UTSW 7 128776885 missense probably damaging 0.99
R1442:Sec23ip UTSW 7 128776786 missense probably benign 0.10
R1462:Sec23ip UTSW 7 128766138 missense probably benign
R1462:Sec23ip UTSW 7 128766138 missense probably benign
R1564:Sec23ip UTSW 7 128766281 splice site probably null
R1876:Sec23ip UTSW 7 128752851 missense probably benign
R1966:Sec23ip UTSW 7 128755353 missense probably damaging 0.98
R1977:Sec23ip UTSW 7 128766273 missense probably damaging 1.00
R2115:Sec23ip UTSW 7 128762461 missense probably benign 0.00
R2847:Sec23ip UTSW 7 128754073 missense probably benign 0.00
R3958:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R3959:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R3960:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R4287:Sec23ip UTSW 7 128777333 missense probably benign 0.37
R4510:Sec23ip UTSW 7 128779176 missense probably damaging 1.00
R4511:Sec23ip UTSW 7 128779176 missense probably damaging 1.00
R4612:Sec23ip UTSW 7 128750502 nonsense probably null
R4660:Sec23ip UTSW 7 128750286 missense probably null 0.00
R4890:Sec23ip UTSW 7 128752910 missense probably damaging 0.98
R5287:Sec23ip UTSW 7 128766136 missense probably benign
R5587:Sec23ip UTSW 7 128750427 missense probably benign
R5625:Sec23ip UTSW 7 128744983 unclassified probably benign
R5656:Sec23ip UTSW 7 128776784 missense probably damaging 1.00
R5808:Sec23ip UTSW 7 128772184 missense probably benign 0.00
R6034:Sec23ip UTSW 7 128750203 missense possibly damaging 0.66
R6034:Sec23ip UTSW 7 128750203 missense possibly damaging 0.66
R6145:Sec23ip UTSW 7 128778484 missense probably damaging 0.99
R6747:Sec23ip UTSW 7 128752849 synonymous silent
R6992:Sec23ip UTSW 7 128765440 missense probably benign
R7131:Sec23ip UTSW 7 128779640 missense probably damaging 1.00
R7163:Sec23ip UTSW 7 128762533 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTACCTGGAAAGACACGTAGG -3'
(R):5'- ATCTGAAAACCTGCACAGATTAAGG -3'

Sequencing Primer
(F):5'- CACGTAGGATAGCTAATACTGATACC -3'
(R):5'- GAATCTGACAGTTGAAAACAAGACC -3'
Posted On2018-11-28