Incidental Mutation 'R6955:Kif5b'
ID541439
Institutional Source Beutler Lab
Gene Symbol Kif5b
Ensembl Gene ENSMUSG00000006740
Gene Namekinesin family member 5B
Synonymskinesin heavy chain, Khc
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6955 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location6201002-6242174 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6211070 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 798 (N798S)
Ref Sequence ENSEMBL: ENSMUSP00000025083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025083] [ENSMUST00000163210]
Predicted Effect probably benign
Transcript: ENSMUST00000025083
AA Change: N798S

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025083
Gene: ENSMUSG00000006740
AA Change: N798S

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
coiled coil region 596 802 N/A INTRINSIC
coiled coil region 825 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163210
SMART Domains Protein: ENSMUSP00000130750
Gene: ENSMUSG00000006740

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos during organogenesis, exhibit growth retardation and fail to turn during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,294,307 F2057I probably benign Het
Abl2 A G 1: 156,622,649 T108A probably damaging Het
Amfr A T 8: 94,000,376 W70R probably damaging Het
Cacna1h T C 17: 25,388,056 T963A probably damaging Het
Cdca2 A G 14: 67,715,004 M1T probably null Het
Chd2 A G 7: 73,475,423 V62A probably damaging Het
Cpeb4 T A 11: 31,908,864 L87Q possibly damaging Het
Ddx17 T C 15: 79,530,467 M500V probably benign Het
Emilin1 T C 5: 30,917,909 L498P probably damaging Het
Fhod1 C T 8: 105,333,007 C682Y probably benign Het
Fshr A T 17: 88,985,466 S595T probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Inf2 T C 12: 112,610,731 V1003A unknown Het
Itpr3 A G 17: 27,121,467 E2651G probably damaging Het
Kalrn A G 16: 34,220,136 W735R probably damaging Het
Kdelc1 A T 1: 44,117,097 L110Q probably damaging Het
Klb T A 5: 65,379,088 L587* probably null Het
Krt82 T A 15: 101,542,849 D375V probably damaging Het
Lig4 A T 8: 9,973,384 V132D probably damaging Het
Lrpprc T C 17: 84,776,989 I99V probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Mcam T A 9: 44,139,269 I286N probably damaging Het
Myh15 G T 16: 49,081,235 probably null Het
Nup210 T C 6: 91,087,927 E197G probably damaging Het
Nup93 T A 8: 94,309,673 Y702N probably damaging Het
Olfr1192-ps1 T A 2: 88,653,004 I284N probably damaging Het
Osbpl8 T C 10: 111,269,444 probably null Het
Pdzd2 A G 15: 12,401,464 S767P probably damaging Het
Plcd1 A T 9: 119,071,856 N765K probably benign Het
Rnf208 T C 2: 25,243,402 V36A probably benign Het
Rpl5 G A 5: 107,902,046 R33Q probably benign Het
Selp A T 1: 164,144,909 I706F possibly damaging Het
Sfmbt1 A G 14: 30,766,034 probably benign Het
Slc25a39 T C 11: 102,403,518 I328V probably benign Het
Smc4 G A 3: 69,024,309 E604K possibly damaging Het
Sorcs3 A G 19: 48,749,343 Y733C possibly damaging Het
Ttll5 T C 12: 85,864,579 V237A possibly damaging Het
Uimc1 T A 13: 55,040,546 R567W possibly damaging Het
Wbp4 A T 14: 79,472,360 I145N probably benign Het
Xbp1 A G 11: 5,522,018 E32G probably null Het
Other mutations in Kif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Kif5b APN 18 6226973 splice site probably benign
IGL01697:Kif5b APN 18 6226871 missense possibly damaging 0.68
IGL01759:Kif5b APN 18 6225647 missense probably damaging 0.99
IGL01759:Kif5b APN 18 6211019 unclassified probably benign
IGL02027:Kif5b APN 18 6209089 missense possibly damaging 0.81
IGL02553:Kif5b APN 18 6220914 missense probably benign 0.00
IGL03327:Kif5b APN 18 6222767 missense probably damaging 0.96
IGL03346:Kif5b APN 18 6222767 missense probably damaging 0.96
e-enhancer UTSW 18 6213272 missense probably benign 0.00
R0440:Kif5b UTSW 18 6226980 splice site probably benign
R0743:Kif5b UTSW 18 6209192 missense probably damaging 1.00
R1241:Kif5b UTSW 18 6214044 missense probably benign 0.07
R1386:Kif5b UTSW 18 6226383 missense probably damaging 0.99
R1720:Kif5b UTSW 18 6213427 missense probably benign
R1964:Kif5b UTSW 18 6209059 missense possibly damaging 0.85
R2061:Kif5b UTSW 18 6226377 splice site probably null
R2091:Kif5b UTSW 18 6213248 nonsense probably null
R4510:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4511:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4515:Kif5b UTSW 18 6208257 missense probably benign
R4517:Kif5b UTSW 18 6213272 missense probably benign 0.00
R4690:Kif5b UTSW 18 6216759 missense probably benign
R4838:Kif5b UTSW 18 6216869 missense probably damaging 1.00
R4865:Kif5b UTSW 18 6222912 intron probably benign
R4906:Kif5b UTSW 18 6220930 missense probably benign 0.00
R5260:Kif5b UTSW 18 6211058 missense probably damaging 1.00
R5290:Kif5b UTSW 18 6234882 missense probably damaging 1.00
R5517:Kif5b UTSW 18 6220954 missense probably benign 0.00
R5588:Kif5b UTSW 18 6225787 missense probably benign 0.03
R5621:Kif5b UTSW 18 6226883 missense probably benign 0.41
R6269:Kif5b UTSW 18 6223558 missense possibly damaging 0.88
R6377:Kif5b UTSW 18 6212562 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGGATCAGAGGACCCACG -3'
(R):5'- GTTGAAAGGATGTAACTGTTGCTTC -3'

Sequencing Primer
(F):5'- GATCAGAGGACCCACGTTCCTC -3'
(R):5'- CAATTTAGGGTTATGCAAGACAGAC -3'
Posted On2018-11-28