Incidental Mutation 'R6956:Tgm4'
ID541466
Institutional Source Beutler Lab
Gene Symbol Tgm4
Ensembl Gene ENSMUSG00000025787
Gene Nametransglutaminase 4 (prostate)
Synonyms9530008N10Rik, Eapa1, experimental autoimmune prostatitis antigen 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6956 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location123034726-123067561 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 123064703 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 155 (M155I)
Ref Sequence ENSEMBL: ENSMUSP00000149120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000140497] [ENSMUST00000215247] [ENSMUST00000217607]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026893
AA Change: M579I

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787
AA Change: M579I

DomainStartEndE-ValueType
Pfam:Transglut_N 8 118 4e-26 PFAM
TGc 247 340 6.25e-42 SMART
Pfam:Transglut_C 573 670 3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140497
SMART Domains Protein: ENSMUSP00000122604
Gene: ENSMUSG00000025786

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000215247
AA Change: M155I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000217607
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in Tgm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tgm4 APN 9 123062382 unclassified probably benign
IGL01402:Tgm4 APN 9 123051454 missense possibly damaging 0.82
IGL02000:Tgm4 APN 9 123056466 missense probably damaging 1.00
IGL02120:Tgm4 APN 9 123046529 missense probably damaging 0.98
IGL03130:Tgm4 APN 9 123056515 missense probably damaging 1.00
IGL03188:Tgm4 APN 9 123045036 missense probably null 0.06
R0329:Tgm4 UTSW 9 123048557 critical splice donor site probably null
R0480:Tgm4 UTSW 9 123062419 missense probably benign
R0644:Tgm4 UTSW 9 123051458 missense probably damaging 1.00
R0990:Tgm4 UTSW 9 123046511 missense probably benign 0.02
R1604:Tgm4 UTSW 9 123045064 missense probably benign 0.39
R1644:Tgm4 UTSW 9 123051416 missense probably damaging 1.00
R2056:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2058:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2059:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2076:Tgm4 UTSW 9 123051095 missense probably benign 0.24
R2437:Tgm4 UTSW 9 123048549 nonsense probably null
R4392:Tgm4 UTSW 9 123066752 missense probably benign 0.10
R4407:Tgm4 UTSW 9 123056530 missense probably damaging 1.00
R4752:Tgm4 UTSW 9 123051386 missense probably damaging 1.00
R5288:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5365:Tgm4 UTSW 9 123066801 missense probably damaging 1.00
R5386:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5790:Tgm4 UTSW 9 123061743 missense probably damaging 0.98
R5890:Tgm4 UTSW 9 123061638 missense probably damaging 1.00
R6102:Tgm4 UTSW 9 123056535 missense probably benign
R6358:Tgm4 UTSW 9 123056518 missense probably damaging 1.00
R6966:Tgm4 UTSW 9 123051142 missense possibly damaging 0.68
R7091:Tgm4 UTSW 9 123040460 missense probably damaging 1.00
R7258:Tgm4 UTSW 9 123062491 missense probably benign 0.02
R7313:Tgm4 UTSW 9 123062491 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTCTGGCAGGACTAGAGAG -3'
(R):5'- AGGGGTTTACATCTCAAAAGTATGG -3'

Sequencing Primer
(F):5'- TCTGGCAGGACTAGAGAGGTAAGC -3'
(R):5'- GCACAGGTATATGTTGGGAAGACTC -3'
Posted On2018-11-28