Incidental Mutation 'R6957:Samd13'
ID541496
Institutional Source Beutler Lab
Gene Symbol Samd13
Ensembl Gene ENSMUSG00000048652
Gene Namesterile alpha motif domain containing 13
SynonymsLOC381481
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R6957 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location146645195-146685592 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 146662669 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124931] [ENSMUST00000125965] [ENSMUST00000147113] [ENSMUST00000197989]
Predicted Effect probably null
Transcript: ENSMUST00000124931
SMART Domains Protein: ENSMUSP00000118464
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125965
SMART Domains Protein: ENSMUSP00000119608
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000147113
SMART Domains Protein: ENSMUSP00000118934
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000197989
SMART Domains Protein: ENSMUSP00000143496
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 9 75 2.2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C A 13: 58,381,961 C279F probably damaging Het
2310009B15Rik A G 1: 138,852,119 S132P probably damaging Het
4932415D10Rik A T 10: 82,293,786 I1130K probably benign Het
Abcb5 A G 12: 118,907,535 F710L probably damaging Het
Acsm4 T G 7: 119,711,399 V503G probably damaging Het
Adam26a T A 8: 43,568,903 M517L probably benign Het
Adcy10 C A 1: 165,564,285 L1345I probably damaging Het
Adgrv1 T C 13: 81,567,490 I860V probably benign Het
Alcam T C 16: 52,276,894 D333G probably damaging Het
Amt C A 9: 108,299,833 F213L possibly damaging Het
Ascc3 A G 10: 50,728,182 T1333A probably damaging Het
Asxl3 C A 18: 22,522,091 L1053I probably damaging Het
Atxn10 T C 15: 85,336,498 S12P probably damaging Het
AU021092 T C 16: 5,212,153 I333V probably benign Het
Birc6 A G 17: 74,579,491 I577V probably benign Het
Cadm2 A T 16: 66,812,838 F132I probably benign Het
Casp3 T A 8: 46,634,273 V85D probably damaging Het
Ccdc85a A T 11: 28,392,944 probably benign Het
Cd22 T C 7: 30,867,574 R760G possibly damaging Het
Cela3a A T 4: 137,408,130 W41R probably damaging Het
Cep164 A G 9: 45,772,280 probably null Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Ddx20 C A 3: 105,684,310 K181N probably benign Het
Dnah14 G C 1: 181,785,175 A3846P possibly damaging Het
Ern1 A C 11: 106,403,539 I813S probably damaging Het
Fam181a G A 12: 103,316,514 G226D probably damaging Het
Fam186a T A 15: 99,946,476 D629V unknown Het
Fam84b T C 15: 60,823,085 T271A probably benign Het
Gipr T A 7: 19,164,604 T26S probably benign Het
Gm3159 A G 14: 4,398,530 R74G possibly damaging Het
Gm8251 C T 1: 44,057,207 C1577Y probably benign Het
Greb1l G A 18: 10,558,786 V1814I probably benign Het
Hacd1 A T 2: 14,044,853 V98E probably damaging Het
Iars T G 13: 49,722,161 F775V probably damaging Het
Il12rb2 G A 6: 67,292,652 L726F possibly damaging Het
Itih4 T C 14: 30,892,603 V474A probably damaging Het
Kmt2a A C 9: 44,820,022 probably benign Het
Ktn1 T A 14: 47,667,353 L196* probably null Het
Lipo4 A G 19: 33,499,367 V327A probably benign Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp4 C A 2: 91,487,042 T837K probably damaging Het
Mad1l1 G T 5: 140,065,817 F664L probably damaging Het
Mecr A G 4: 131,861,861 T247A probably benign Het
Msi1 G A 5: 115,445,424 A228T probably benign Het
Mup5 T A 4: 61,833,036 N125I probably damaging Het
Mybl2 C T 2: 163,072,808 S282F possibly damaging Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nalcn T C 14: 123,507,554 D354G probably damaging Het
Nckap1l T C 15: 103,491,511 V1040A possibly damaging Het
Nlrp12 T A 7: 3,222,486 D1051V probably damaging Het
Nudt7 A G 8: 114,133,645 K16R probably benign Het
Olfr1270 G T 2: 90,149,150 Y285* probably null Het
Olfr947-ps1 A G 9: 39,289,281 V203A unknown Het
Paqr3 A T 5: 97,108,251 I88K possibly damaging Het
Parp9 A G 16: 35,948,346 M299V probably benign Het
Pde4dip A T 3: 97,824,333 probably null Het
Pex13 T G 11: 23,655,628 M201L probably benign Het
Pfas C A 11: 68,993,883 V498L probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Plec T A 15: 76,186,214 D932V probably damaging Het
Qsox2 C T 2: 26,217,642 A445T probably benign Het
Rapgef1 C A 2: 29,733,698 Q820K possibly damaging Het
Samm50 G T 15: 84,198,649 D104Y probably damaging Het
Sbk3 A T 7: 4,967,523 F282L probably benign Het
Sfmbt1 C T 14: 30,787,589 H342Y probably benign Het
Sgo2b CCATCATCATCATCATCATCAT CCATCATCATCATCATCAT 8: 63,931,455 probably benign Het
Slc12a2 T A 18: 57,910,272 L596* probably null Het
St8sia3 T C 18: 64,271,782 S377P probably benign Het
Stmnd1 T G 13: 46,273,899 S28A probably benign Het
Syne3 A T 12: 104,954,302 L458Q probably damaging Het
Synm C T 7: 67,736,100 V163I probably benign Het
Tbc1d23 A G 16: 57,208,323 C161R probably damaging Het
Tnfrsf4 G A 4: 156,016,168 V215I probably benign Het
Vars2 T G 17: 35,667,075 K67Q probably benign Het
Vmn2r13 A T 5: 109,156,887 Y559* probably null Het
Wdpcp T C 11: 21,721,154 I465T possibly damaging Het
Zwilch A C 9: 64,162,562 probably null Het
Other mutations in Samd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03290:Samd13 APN 3 146646315 missense probably benign 0.31
R1626:Samd13 UTSW 3 146662726 missense probably benign 0.40
R1699:Samd13 UTSW 3 146662714 missense probably benign 0.01
R1717:Samd13 UTSW 3 146646315 missense probably benign 0.31
R1919:Samd13 UTSW 3 146662712 missense probably benign
R2289:Samd13 UTSW 3 146662691 missense probably damaging 0.99
R4923:Samd13 UTSW 3 146662747 missense probably benign 0.06
R5617:Samd13 UTSW 3 146646310 missense probably benign 0.05
R5964:Samd13 UTSW 3 146680696 intron probably benign
R7250:Samd13 UTSW 3 146646324 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GGAACTGTGTCTCTTCAGTCTG -3'
(R):5'- CTCTGAGGGAAATGAGCACCAG -3'

Sequencing Primer
(F):5'- ACTGTGTCTCTTCAGTCTGAGTTATC -3'
(R):5'- TGAGCTGGCTCAGACCAG -3'
Posted On2018-11-28