Incidental Mutation 'R6957:Casp3'
ID541514
Institutional Source Beutler Lab
Gene Symbol Casp3
Ensembl Gene ENSMUSG00000031628
Gene Namecaspase 3
Synonymsmldy, Yama, Caspase-3, Apopain, CPP32, A830040C14Rik, CC3, AC-3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6957 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location46617291-46639689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46634273 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 85 (V85D)
Ref Sequence ENSEMBL: ENSMUSP00000147767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093517] [ENSMUST00000210534] [ENSMUST00000211115]
Predicted Effect probably damaging
Transcript: ENSMUST00000093517
AA Change: V85D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091238
Gene: ENSMUSG00000031628
AA Change: V85D

DomainStartEndE-ValueType
CASc 36 277 9.95e-143 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210534
AA Change: V85D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211115
AA Change: V85D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to a highly conserved family of cysteinyl aspartate-specific proteases that function as essential regulators of programmed cell death through apoptosis. Members of this family contain an N-terminal pro-domain and require cleavage at specific aspartate residues to become mature. The protein encoded by this gene belongs to a subgroup of cysteinyl aspartate-specific proteases that are activated by initiator caspases and that perform the proteolytic cleavage of apoptotic target proteins. Mice defective for this gene exhibit a variety of phenotypes including reduced neuronal apoptosis resulting in hyperplasias, hearing loss, attenuated osteogenic differentiation of bone marrow stromal stem cells, and pre- and post-natal lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Some homozygous animals show defects in brain development by embryonic day 12, reduced neuronal apoptosis causing hyperplasias, and pre- and postnatal lethality. Other homozygous animals exhibit only hearing loss, inner ear defects and degeneration of spiral ganglion neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C A 13: 58,381,961 C279F probably damaging Het
2310009B15Rik A G 1: 138,852,119 S132P probably damaging Het
4932415D10Rik A T 10: 82,293,786 I1130K probably benign Het
Abcb5 A G 12: 118,907,535 F710L probably damaging Het
Acsm4 T G 7: 119,711,399 V503G probably damaging Het
Adam26a T A 8: 43,568,903 M517L probably benign Het
Adcy10 C A 1: 165,564,285 L1345I probably damaging Het
Adgrv1 T C 13: 81,567,490 I860V probably benign Het
Alcam T C 16: 52,276,894 D333G probably damaging Het
Amt C A 9: 108,299,833 F213L possibly damaging Het
Ascc3 A G 10: 50,728,182 T1333A probably damaging Het
Asxl3 C A 18: 22,522,091 L1053I probably damaging Het
Atxn10 T C 15: 85,336,498 S12P probably damaging Het
AU021092 T C 16: 5,212,153 I333V probably benign Het
Birc6 A G 17: 74,579,491 I577V probably benign Het
Cadm2 A T 16: 66,812,838 F132I probably benign Het
Ccdc85a A T 11: 28,392,944 probably benign Het
Cd22 T C 7: 30,867,574 R760G possibly damaging Het
Cela3a A T 4: 137,408,130 W41R probably damaging Het
Cep164 A G 9: 45,772,280 probably null Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Ddx20 C A 3: 105,684,310 K181N probably benign Het
Dnah14 G C 1: 181,785,175 A3846P possibly damaging Het
Ern1 A C 11: 106,403,539 I813S probably damaging Het
Fam181a G A 12: 103,316,514 G226D probably damaging Het
Fam186a T A 15: 99,946,476 D629V unknown Het
Fam84b T C 15: 60,823,085 T271A probably benign Het
Gipr T A 7: 19,164,604 T26S probably benign Het
Gm3159 A G 14: 4,398,530 R74G possibly damaging Het
Gm8251 C T 1: 44,057,207 C1577Y probably benign Het
Greb1l G A 18: 10,558,786 V1814I probably benign Het
Hacd1 A T 2: 14,044,853 V98E probably damaging Het
Iars T G 13: 49,722,161 F775V probably damaging Het
Il12rb2 G A 6: 67,292,652 L726F possibly damaging Het
Itih4 T C 14: 30,892,603 V474A probably damaging Het
Kmt2a A C 9: 44,820,022 probably benign Het
Ktn1 T A 14: 47,667,353 L196* probably null Het
Lipo4 A G 19: 33,499,367 V327A probably benign Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp4 C A 2: 91,487,042 T837K probably damaging Het
Mad1l1 G T 5: 140,065,817 F664L probably damaging Het
Mecr A G 4: 131,861,861 T247A probably benign Het
Msi1 G A 5: 115,445,424 A228T probably benign Het
Mup5 T A 4: 61,833,036 N125I probably damaging Het
Mybl2 C T 2: 163,072,808 S282F possibly damaging Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nalcn T C 14: 123,507,554 D354G probably damaging Het
Nckap1l T C 15: 103,491,511 V1040A possibly damaging Het
Nlrp12 T A 7: 3,222,486 D1051V probably damaging Het
Nudt7 A G 8: 114,133,645 K16R probably benign Het
Olfr1270 G T 2: 90,149,150 Y285* probably null Het
Olfr947-ps1 A G 9: 39,289,281 V203A unknown Het
Paqr3 A T 5: 97,108,251 I88K possibly damaging Het
Parp9 A G 16: 35,948,346 M299V probably benign Het
Pde4dip A T 3: 97,824,333 probably null Het
Pex13 T G 11: 23,655,628 M201L probably benign Het
Pfas C A 11: 68,993,883 V498L probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Plec T A 15: 76,186,214 D932V probably damaging Het
Qsox2 C T 2: 26,217,642 A445T probably benign Het
Rapgef1 C A 2: 29,733,698 Q820K possibly damaging Het
Samd13 A G 3: 146,662,669 probably null Het
Samm50 G T 15: 84,198,649 D104Y probably damaging Het
Sbk3 A T 7: 4,967,523 F282L probably benign Het
Sfmbt1 C T 14: 30,787,589 H342Y probably benign Het
Sgo2b CCATCATCATCATCATCATCAT CCATCATCATCATCATCAT 8: 63,931,455 probably benign Het
Slc12a2 T A 18: 57,910,272 L596* probably null Het
St8sia3 T C 18: 64,271,782 S377P probably benign Het
Stmnd1 T G 13: 46,273,899 S28A probably benign Het
Syne3 A T 12: 104,954,302 L458Q probably damaging Het
Synm C T 7: 67,736,100 V163I probably benign Het
Tbc1d23 A G 16: 57,208,323 C161R probably damaging Het
Tnfrsf4 G A 4: 156,016,168 V215I probably benign Het
Vars2 T G 17: 35,667,075 K67Q probably benign Het
Vmn2r13 A T 5: 109,156,887 Y559* probably null Het
Wdpcp T C 11: 21,721,154 I465T possibly damaging Het
Zwilch A C 9: 64,162,562 probably null Het
Other mutations in Casp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Casp3 APN 8 46629741 utr 5 prime probably benign
warner UTSW 8 46635388 missense probably damaging 1.00
R0601:Casp3 UTSW 8 46636227 missense probably benign 0.00
R1541:Casp3 UTSW 8 46634334 missense probably benign 0.02
R1648:Casp3 UTSW 8 46638074 missense probably benign
R2046:Casp3 UTSW 8 46629726 splice site probably benign
R2159:Casp3 UTSW 8 46634288 missense probably damaging 1.00
R2176:Casp3 UTSW 8 46629756 missense probably damaging 1.00
R2251:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R2252:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R2253:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R4095:Casp3 UTSW 8 46634216 missense probably damaging 1.00
R4209:Casp3 UTSW 8 46635388 missense probably damaging 1.00
R4211:Casp3 UTSW 8 46635388 missense probably damaging 1.00
R4868:Casp3 UTSW 8 46634279 missense probably benign 0.01
R5713:Casp3 UTSW 8 46636314 missense probably damaging 1.00
R6847:Casp3 UTSW 8 46636266 missense probably benign 0.00
R7196:Casp3 UTSW 8 46635463 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCGTTTAAAAGGAAGGAGTTTACTG -3'
(R):5'- TGTAAGGATGCGGACTGCTG -3'

Sequencing Primer
(F):5'- TAAAAGGAAGGAGTTTACTGGTTGTG -3'
(R):5'- TGCTGGATCCTGCTAGCAG -3'
Posted On2018-11-28