Incidental Mutation 'R6957:Amt'
ID541521
Institutional Source Beutler Lab
Gene Symbol Amt
Ensembl Gene ENSMUSG00000032607
Gene Nameaminomethyltransferase
SynonymsEG434437
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6957 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108296853-108302302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108299833 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 213 (F213L)
Ref Sequence ENSEMBL: ENSMUSP00000035230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035227] [ENSMUST00000035230] [ENSMUST00000044725] [ENSMUST00000192886] [ENSMUST00000195615]
Predicted Effect probably benign
Transcript: ENSMUST00000035227
Predicted Effect possibly damaging
Transcript: ENSMUST00000035230
AA Change: F213L

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035230
Gene: ENSMUSG00000032607
AA Change: F213L

DomainStartEndE-ValueType
Pfam:GCV_T 38 291 7.8e-86 PFAM
Pfam:GCV_T_C 300 392 1.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044725
SMART Domains Protein: ENSMUSP00000045063
Gene: ENSMUSG00000039461

DomainStartEndE-ValueType
Pfam:T_cell_tran_alt 15 122 1.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192886
SMART Domains Protein: ENSMUSP00000142002
Gene: ENSMUSG00000039461

DomainStartEndE-ValueType
Pfam:T_cell_tran_alt 15 106 1.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195615
SMART Domains Protein: ENSMUSP00000141592
Gene: ENSMUSG00000039461

DomainStartEndE-ValueType
Pfam:T_cell_tran_alt 15 103 2.9e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of four critical components of the glycine cleavage system. Mutations in this gene have been associated with glycine encephalopathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele develop neural tubes defects at high frequency and exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C A 13: 58,381,961 C279F probably damaging Het
2310009B15Rik A G 1: 138,852,119 S132P probably damaging Het
4932415D10Rik A T 10: 82,293,786 I1130K probably benign Het
Abcb5 A G 12: 118,907,535 F710L probably damaging Het
Acsm4 T G 7: 119,711,399 V503G probably damaging Het
Adam26a T A 8: 43,568,903 M517L probably benign Het
Adcy10 C A 1: 165,564,285 L1345I probably damaging Het
Adgrv1 T C 13: 81,567,490 I860V probably benign Het
Alcam T C 16: 52,276,894 D333G probably damaging Het
Ascc3 A G 10: 50,728,182 T1333A probably damaging Het
Asxl3 C A 18: 22,522,091 L1053I probably damaging Het
Atxn10 T C 15: 85,336,498 S12P probably damaging Het
AU021092 T C 16: 5,212,153 I333V probably benign Het
Birc6 A G 17: 74,579,491 I577V probably benign Het
Cadm2 A T 16: 66,812,838 F132I probably benign Het
Casp3 T A 8: 46,634,273 V85D probably damaging Het
Ccdc85a A T 11: 28,392,944 probably benign Het
Cd22 T C 7: 30,867,574 R760G possibly damaging Het
Cela3a A T 4: 137,408,130 W41R probably damaging Het
Cep164 A G 9: 45,772,280 probably null Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Ddx20 C A 3: 105,684,310 K181N probably benign Het
Dnah14 G C 1: 181,785,175 A3846P possibly damaging Het
Ern1 A C 11: 106,403,539 I813S probably damaging Het
Fam181a G A 12: 103,316,514 G226D probably damaging Het
Fam186a T A 15: 99,946,476 D629V unknown Het
Fam84b T C 15: 60,823,085 T271A probably benign Het
Gipr T A 7: 19,164,604 T26S probably benign Het
Gm3159 A G 14: 4,398,530 R74G possibly damaging Het
Gm8251 C T 1: 44,057,207 C1577Y probably benign Het
Greb1l G A 18: 10,558,786 V1814I probably benign Het
Hacd1 A T 2: 14,044,853 V98E probably damaging Het
Iars T G 13: 49,722,161 F775V probably damaging Het
Il12rb2 G A 6: 67,292,652 L726F possibly damaging Het
Itih4 T C 14: 30,892,603 V474A probably damaging Het
Kmt2a A C 9: 44,820,022 probably benign Het
Ktn1 T A 14: 47,667,353 L196* probably null Het
Lipo4 A G 19: 33,499,367 V327A probably benign Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp4 C A 2: 91,487,042 T837K probably damaging Het
Mad1l1 G T 5: 140,065,817 F664L probably damaging Het
Mecr A G 4: 131,861,861 T247A probably benign Het
Msi1 G A 5: 115,445,424 A228T probably benign Het
Mup5 T A 4: 61,833,036 N125I probably damaging Het
Mybl2 C T 2: 163,072,808 S282F possibly damaging Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nalcn T C 14: 123,507,554 D354G probably damaging Het
Nckap1l T C 15: 103,491,511 V1040A possibly damaging Het
Nlrp12 T A 7: 3,222,486 D1051V probably damaging Het
Nudt7 A G 8: 114,133,645 K16R probably benign Het
Olfr1270 G T 2: 90,149,150 Y285* probably null Het
Olfr947-ps1 A G 9: 39,289,281 V203A unknown Het
Paqr3 A T 5: 97,108,251 I88K possibly damaging Het
Parp9 A G 16: 35,948,346 M299V probably benign Het
Pde4dip A T 3: 97,824,333 probably null Het
Pex13 T G 11: 23,655,628 M201L probably benign Het
Pfas C A 11: 68,993,883 V498L probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Plec T A 15: 76,186,214 D932V probably damaging Het
Qsox2 C T 2: 26,217,642 A445T probably benign Het
Rapgef1 C A 2: 29,733,698 Q820K possibly damaging Het
Samd13 A G 3: 146,662,669 probably null Het
Samm50 G T 15: 84,198,649 D104Y probably damaging Het
Sbk3 A T 7: 4,967,523 F282L probably benign Het
Sfmbt1 C T 14: 30,787,589 H342Y probably benign Het
Sgo2b CCATCATCATCATCATCATCAT CCATCATCATCATCATCAT 8: 63,931,455 probably benign Het
Slc12a2 T A 18: 57,910,272 L596* probably null Het
St8sia3 T C 18: 64,271,782 S377P probably benign Het
Stmnd1 T G 13: 46,273,899 S28A probably benign Het
Syne3 A T 12: 104,954,302 L458Q probably damaging Het
Synm C T 7: 67,736,100 V163I probably benign Het
Tbc1d23 A G 16: 57,208,323 C161R probably damaging Het
Tnfrsf4 G A 4: 156,016,168 V215I probably benign Het
Vars2 T G 17: 35,667,075 K67Q probably benign Het
Vmn2r13 A T 5: 109,156,887 Y559* probably null Het
Wdpcp T C 11: 21,721,154 I465T possibly damaging Het
Zwilch A C 9: 64,162,562 probably null Het
Other mutations in Amt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02657:Amt APN 9 108301380 missense probably damaging 1.00
IGL03277:Amt APN 9 108301219 missense probably benign
R1333:Amt UTSW 9 108301097 missense probably benign 0.04
R1856:Amt UTSW 9 108297162 missense probably damaging 1.00
R3843:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3844:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3903:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3904:Amt UTSW 9 108297221 missense possibly damaging 0.74
R4729:Amt UTSW 9 108300652 missense probably damaging 1.00
R4814:Amt UTSW 9 108299780 missense probably benign
R5149:Amt UTSW 9 108301451 missense possibly damaging 0.59
R6000:Amt UTSW 9 108301485 missense probably benign 0.20
R6044:Amt UTSW 9 108297251 missense probably damaging 1.00
R6911:Amt UTSW 9 108301229 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTTGCAGAGTTGGGCTTG -3'
(R):5'- CAATCCTATTCCTCTGTCTGAGACA -3'

Sequencing Primer
(F):5'- GCTTGCTTGGGACTTCTTCTGC -3'
(R):5'- CTTGACTTACCTCAACACCAT -3'
Posted On2018-11-28