Incidental Mutation 'R6957:Nalcn'
ID541541
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Namesodium leak channel, non-selective
SynonymsA530023G15Rik, Vgcnl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6957 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location123276634-123627144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123507554 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 354 (D354G)
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
Predicted Effect probably damaging
Transcript: ENSMUST00000000201
AA Change: D354G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197
AA Change: D354G

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C A 13: 58,381,961 C279F probably damaging Het
2310009B15Rik A G 1: 138,852,119 S132P probably damaging Het
4932415D10Rik A T 10: 82,293,786 I1130K probably benign Het
Abcb5 A G 12: 118,907,535 F710L probably damaging Het
Acsm4 T G 7: 119,711,399 V503G probably damaging Het
Adam26a T A 8: 43,568,903 M517L probably benign Het
Adcy10 C A 1: 165,564,285 L1345I probably damaging Het
Adgrv1 T C 13: 81,567,490 I860V probably benign Het
Alcam T C 16: 52,276,894 D333G probably damaging Het
Amt C A 9: 108,299,833 F213L possibly damaging Het
Ascc3 A G 10: 50,728,182 T1333A probably damaging Het
Asxl3 C A 18: 22,522,091 L1053I probably damaging Het
Atxn10 T C 15: 85,336,498 S12P probably damaging Het
AU021092 T C 16: 5,212,153 I333V probably benign Het
Birc6 A G 17: 74,579,491 I577V probably benign Het
Cadm2 A T 16: 66,812,838 F132I probably benign Het
Casp3 T A 8: 46,634,273 V85D probably damaging Het
Ccdc85a A T 11: 28,392,944 probably benign Het
Cd22 T C 7: 30,867,574 R760G possibly damaging Het
Cela3a A T 4: 137,408,130 W41R probably damaging Het
Cep164 A G 9: 45,772,280 probably null Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Ddx20 C A 3: 105,684,310 K181N probably benign Het
Dnah14 G C 1: 181,785,175 A3846P possibly damaging Het
Ern1 A C 11: 106,403,539 I813S probably damaging Het
Fam181a G A 12: 103,316,514 G226D probably damaging Het
Fam186a T A 15: 99,946,476 D629V unknown Het
Fam84b T C 15: 60,823,085 T271A probably benign Het
Gipr T A 7: 19,164,604 T26S probably benign Het
Gm3159 A G 14: 4,398,530 R74G possibly damaging Het
Gm8251 C T 1: 44,057,207 C1577Y probably benign Het
Greb1l G A 18: 10,558,786 V1814I probably benign Het
Hacd1 A T 2: 14,044,853 V98E probably damaging Het
Iars T G 13: 49,722,161 F775V probably damaging Het
Il12rb2 G A 6: 67,292,652 L726F possibly damaging Het
Itih4 T C 14: 30,892,603 V474A probably damaging Het
Kmt2a A C 9: 44,820,022 probably benign Het
Ktn1 T A 14: 47,667,353 L196* probably null Het
Lipo4 A G 19: 33,499,367 V327A probably benign Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp4 C A 2: 91,487,042 T837K probably damaging Het
Mad1l1 G T 5: 140,065,817 F664L probably damaging Het
Mecr A G 4: 131,861,861 T247A probably benign Het
Msi1 G A 5: 115,445,424 A228T probably benign Het
Mup5 T A 4: 61,833,036 N125I probably damaging Het
Mybl2 C T 2: 163,072,808 S282F possibly damaging Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nckap1l T C 15: 103,491,511 V1040A possibly damaging Het
Nlrp12 T A 7: 3,222,486 D1051V probably damaging Het
Nudt7 A G 8: 114,133,645 K16R probably benign Het
Olfr1270 G T 2: 90,149,150 Y285* probably null Het
Olfr947-ps1 A G 9: 39,289,281 V203A unknown Het
Paqr3 A T 5: 97,108,251 I88K possibly damaging Het
Parp9 A G 16: 35,948,346 M299V probably benign Het
Pde4dip A T 3: 97,824,333 probably null Het
Pex13 T G 11: 23,655,628 M201L probably benign Het
Pfas C A 11: 68,993,883 V498L probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Plec T A 15: 76,186,214 D932V probably damaging Het
Qsox2 C T 2: 26,217,642 A445T probably benign Het
Rapgef1 C A 2: 29,733,698 Q820K possibly damaging Het
Samd13 A G 3: 146,662,669 probably null Het
Samm50 G T 15: 84,198,649 D104Y probably damaging Het
Sbk3 A T 7: 4,967,523 F282L probably benign Het
Sfmbt1 C T 14: 30,787,589 H342Y probably benign Het
Sgo2b CCATCATCATCATCATCATCAT CCATCATCATCATCATCAT 8: 63,931,455 probably benign Het
Slc12a2 T A 18: 57,910,272 L596* probably null Het
St8sia3 T C 18: 64,271,782 S377P probably benign Het
Stmnd1 T G 13: 46,273,899 S28A probably benign Het
Syne3 A T 12: 104,954,302 L458Q probably damaging Het
Synm C T 7: 67,736,100 V163I probably benign Het
Tbc1d23 A G 16: 57,208,323 C161R probably damaging Het
Tnfrsf4 G A 4: 156,016,168 V215I probably benign Het
Vars2 T G 17: 35,667,075 K67Q probably benign Het
Vmn2r13 A T 5: 109,156,887 Y559* probably null Het
Wdpcp T C 11: 21,721,154 I465T possibly damaging Het
Zwilch A C 9: 64,162,562 probably null Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123348789 missense probably benign 0.00
IGL00964:Nalcn APN 14 123295384 splice site probably benign
IGL01310:Nalcn APN 14 123317249 missense probably benign 0.00
IGL01578:Nalcn APN 14 123572091 missense probably benign 0.00
IGL01925:Nalcn APN 14 123291848 missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123323358 missense probably benign 0.05
IGL02096:Nalcn APN 14 123594503 missense probably benign 0.11
IGL02212:Nalcn APN 14 123515330 missense probably damaging 0.99
IGL02306:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02471:Nalcn APN 14 123323314 missense probably benign 0.02
IGL02478:Nalcn APN 14 123321305 missense probably benign 0.26
IGL02551:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02630:Nalcn APN 14 123317879 missense probably benign 0.16
IGL02632:Nalcn APN 14 123317853 missense probably benign 0.11
IGL02661:Nalcn APN 14 123592909 splice site probably benign
IGL02830:Nalcn APN 14 123293469 missense probably damaging 0.98
IGL02939:Nalcn APN 14 123298872 missense probably null 1.00
IGL03035:Nalcn APN 14 123278218 nonsense probably null
IGL03226:Nalcn APN 14 123281115 missense probably benign 0.00
IGL03242:Nalcn APN 14 123321487 missense possibly damaging 0.91
Narnia UTSW 14 123291047 missense probably benign 0.11
R0019:Nalcn UTSW 14 123507489 missense probably benign 0.18
R0144:Nalcn UTSW 14 123371536 missense probably damaging 0.96
R0144:Nalcn UTSW 14 123409839 splice site probably benign
R0359:Nalcn UTSW 14 123299168 missense probably damaging 1.00
R0383:Nalcn UTSW 14 123507559 missense probably benign 0.01
R0400:Nalcn UTSW 14 123290960 splice site probably benign
R0467:Nalcn UTSW 14 123291047 missense probably benign 0.11
R0506:Nalcn UTSW 14 123596614 missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123294343 missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123299141 splice site probably benign
R0624:Nalcn UTSW 14 123370032 missense probably benign
R0883:Nalcn UTSW 14 123464740 missense probably damaging 1.00
R1381:Nalcn UTSW 14 123314105 missense probably damaging 1.00
R1467:Nalcn UTSW 14 123464656 splice site probably benign
R1689:Nalcn UTSW 14 123285254 missense probably damaging 1.00
R1726:Nalcn UTSW 14 123308404 missense probably damaging 1.00
R1774:Nalcn UTSW 14 123278266 missense probably benign
R1854:Nalcn UTSW 14 123460412 missense probably damaging 1.00
R1869:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123283601 missense probably benign 0.00
R1899:Nalcn UTSW 14 123316126 missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123302769 missense probably benign 0.08
R2016:Nalcn UTSW 14 123594581 splice site probably null
R2034:Nalcn UTSW 14 123283603 missense probably benign 0.01
R2087:Nalcn UTSW 14 123281145 missense probably benign
R2149:Nalcn UTSW 14 123370017 missense probably benign 0.01
R2157:Nalcn UTSW 14 123409752 missense probably benign 0.32
R2166:Nalcn UTSW 14 123369951 missense probably benign 0.00
R2932:Nalcn UTSW 14 123593018 missense probably benign 0.06
R3408:Nalcn UTSW 14 123596617 missense probably null 0.98
R3778:Nalcn UTSW 14 123464716 missense probably damaging 1.00
R3807:Nalcn UTSW 14 123278187 missense probably damaging 1.00
R3835:Nalcn UTSW 14 123293422 splice site probably benign
R3937:Nalcn UTSW 14 123369945 missense probably benign 0.00
R4001:Nalcn UTSW 14 123596594 missense probably damaging 1.00
R4015:Nalcn UTSW 14 123486387 missense probably damaging 1.00
R4033:Nalcn UTSW 14 123599989 splice site probably benign
R4231:Nalcn UTSW 14 123599913 missense probably benign 0.01
R4464:Nalcn UTSW 14 123323350 missense probably benign
R4512:Nalcn UTSW 14 123295448 missense probably damaging 1.00
R4542:Nalcn UTSW 14 123321477 synonymous silent
R4557:Nalcn UTSW 14 123321235 intron probably benign
R4869:Nalcn UTSW 14 123599884 missense probably benign 0.44
R5083:Nalcn UTSW 14 123323294 splice site probably null
R5109:Nalcn UTSW 14 123278238 missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123515770 missense probably damaging 0.98
R5158:Nalcn UTSW 14 123515737 missense probably damaging 1.00
R5259:Nalcn UTSW 14 123515651 missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123515365 missense probably damaging 1.00
R5514:Nalcn UTSW 14 123283711 missense probably benign 0.14
R5523:Nalcn UTSW 14 123409743 missense probably damaging 1.00
R5551:Nalcn UTSW 14 123278286 missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5671:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5750:Nalcn UTSW 14 123572038 missense probably benign
R5765:Nalcn UTSW 14 123464726 missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123409749 missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123317843 missense probably benign 0.00
R6558:Nalcn UTSW 14 123486507 missense probably benign
R6631:Nalcn UTSW 14 123460251 missense probably benign 0.17
R6667:Nalcn UTSW 14 123321323 missense probably damaging 1.00
R6670:Nalcn UTSW 14 123464672 missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123298067 missense probably damaging 0.99
R6731:Nalcn UTSW 14 123599934 missense probably benign 0.22
R6970:Nalcn UTSW 14 123314094 missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123293465 missense probably damaging 1.00
R7018:Nalcn UTSW 14 123409821 missense probably damaging 1.00
R7040:Nalcn UTSW 14 123287855 missense probably benign
R7089:Nalcn UTSW 14 123278349 missense probably benign 0.01
R7128:Nalcn UTSW 14 123594502 missense probably damaging 0.99
R7149:Nalcn UTSW 14 123599865 missense probably benign 0.02
X0060:Nalcn UTSW 14 123285241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTGGGCAAGTTTAGAGCTTGG -3'
(R):5'- GCAAGCTATTATCATTGCTCATGAG -3'

Sequencing Primer
(F):5'- AGAGCTTGGAGCCTATGAATTTC -3'
(R):5'- GCTATTATCATTGCTCATGAGAGTAG -3'
Posted On2018-11-28