Incidental Mutation 'R6958:Dusp27'
ID541565
Institutional Source Beutler Lab
Gene Symbol Dusp27
Ensembl Gene ENSMUSG00000026564
Gene Namedual specificity phosphatase 27 (putative)
SynonymsC130085G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6958 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location166098148-166127922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 166107996 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 211 (D211V)
Ref Sequence ENSEMBL: ENSMUSP00000141564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
Predicted Effect probably damaging
Transcript: ENSMUST00000085992
AA Change: D211V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: D211V

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192369
AA Change: D211V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: D211V

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,943,803 D159G probably benign Het
Ahnak A G 19: 9,015,215 N4621S possibly damaging Het
Ankrd16 C T 2: 11,779,793 A144V probably damaging Het
BC080695 A T 4: 143,571,259 D83V probably damaging Het
Ccdc14 T C 16: 34,690,806 V2A probably damaging Het
Ccdc187 C T 2: 26,289,719 V243I probably benign Het
Cdk12 A T 11: 98,241,699 I985F unknown Het
Cfap65 T C 1: 74,931,899 T87A possibly damaging Het
Cilp2 G A 8: 69,882,540 P603S probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cpa6 C T 1: 10,595,688 V42M probably damaging Het
Cpsf4 A G 5: 145,175,592 I115V probably benign Het
Dnah11 G T 12: 117,933,809 P3562Q probably damaging Het
Dnah9 A G 11: 66,076,341 F1664L probably damaging Het
Dpysl3 T C 18: 43,438,002 Q69R probably benign Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Eif2ak3 T A 6: 70,892,683 C785S probably benign Het
Elk4 T A 1: 132,017,832 F149L probably damaging Het
Fgf14 A G 14: 124,676,597 W41R probably benign Het
Fmnl1 T A 11: 103,171,314 M1K probably null Het
Foxk2 A T 11: 121,299,737 Q568L probably benign Het
Fryl T G 5: 73,073,929 I1602L possibly damaging Het
Gfm2 A G 13: 97,146,236 I75V probably damaging Het
Gm3233 T A 10: 77,759,535 probably benign Het
Gm5096 G A 18: 87,756,922 E190K probably benign Het
Gnb1 G T 4: 155,543,194 probably null Het
Gphn G T 12: 78,680,299 V662L possibly damaging Het
Il3 A C 11: 54,267,111 V47G probably benign Het
Iqgap3 A G 3: 88,113,366 D401G possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Krtap6-2 A G 16: 89,419,810 S90P unknown Het
Lars C T 18: 42,236,639 V394I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp10 A G 14: 54,469,821 probably benign Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Lzts2 G T 19: 45,024,143 probably benign Het
Msantd2 A G 9: 37,523,457 E331G probably damaging Het
Myo15 G A 11: 60,503,625 G1218S probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nhp2 A G 11: 51,623,107 T118A probably benign Het
Nup155 A G 15: 8,147,154 Y972C probably damaging Het
Nxpe2 A T 9: 48,326,266 C230S probably damaging Het
Olfr103 T C 17: 37,336,417 I272V probably benign Het
Olfr1151 T C 2: 87,857,951 Y259H probably damaging Het
Olfr577 A G 7: 102,973,884 L36P possibly damaging Het
Pfkfb4 A T 9: 109,010,547 N244I probably damaging Het
Pi4ka C T 16: 17,325,227 R24Q probably damaging Het
Pkd2l2 C A 18: 34,409,490 Y8* probably null Het
Ptprb T A 10: 116,277,248 N44K probably benign Het
Sds G A 5: 120,481,472 V149M probably damaging Het
Slc22a30 A G 19: 8,386,701 F204L probably damaging Het
Slc26a7 C T 4: 14,506,442 A636T probably benign Het
Slc27a1 C T 8: 71,585,439 A577V possibly damaging Het
Spata13 A T 14: 60,751,851 T319S possibly damaging Het
Tdrd3 A G 14: 87,457,096 D29G probably damaging Het
Tex15 A T 8: 33,570,871 I110L probably benign Het
Treml2 A G 17: 48,308,152 T222A probably damaging Het
Trpd52l3 A T 19: 30,004,146 L100F probably damaging Het
Ttf2 C T 3: 100,945,932 E975K probably benign Het
Vmn1r193 T A 13: 22,219,974 probably benign Het
Xpo1 A G 11: 23,285,855 T648A probably benign Het
Zfp641 C T 15: 98,292,951 V71I possibly damaging Het
Other mutations in Dusp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Dusp27 APN 1 166100552 missense probably benign 0.00
IGL00973:Dusp27 APN 1 166099458 missense probably benign
IGL01331:Dusp27 APN 1 166108180 missense probably damaging 1.00
IGL01466:Dusp27 APN 1 166100504 missense probably damaging 1.00
IGL01572:Dusp27 APN 1 166100372 missense probably benign 0.18
IGL01906:Dusp27 APN 1 166099523 missense probably damaging 1.00
IGL01974:Dusp27 APN 1 166100536 nonsense probably null
IGL02112:Dusp27 APN 1 166099671 nonsense probably null
IGL02805:Dusp27 APN 1 166099061 missense probably damaging 1.00
IGL03343:Dusp27 APN 1 166099448 missense probably benign 0.00
R0116:Dusp27 UTSW 1 166099701 missense probably benign 0.19
R0367:Dusp27 UTSW 1 166100763 missense probably benign 0.05
R0499:Dusp27 UTSW 1 166099101 missense probably benign 0.00
R0542:Dusp27 UTSW 1 166101284 missense possibly damaging 0.90
R1312:Dusp27 UTSW 1 166099291 missense possibly damaging 0.46
R1572:Dusp27 UTSW 1 166099455 missense possibly damaging 0.68
R1598:Dusp27 UTSW 1 166110259 missense probably benign 0.10
R1858:Dusp27 UTSW 1 166100846 missense possibly damaging 0.87
R2021:Dusp27 UTSW 1 166100823 missense probably benign 0.00
R2970:Dusp27 UTSW 1 166099229 missense probably benign 0.04
R3727:Dusp27 UTSW 1 166099506 missense probably damaging 1.00
R4041:Dusp27 UTSW 1 166100111 missense probably benign 0.01
R4245:Dusp27 UTSW 1 166101116 missense probably damaging 1.00
R4955:Dusp27 UTSW 1 166108092 missense probably damaging 1.00
R4967:Dusp27 UTSW 1 166127106 missense probably damaging 1.00
R5040:Dusp27 UTSW 1 166100345 missense probably benign 0.17
R5342:Dusp27 UTSW 1 166110250 missense probably benign 0.01
R5467:Dusp27 UTSW 1 166112030 critical splice donor site probably null
R5742:Dusp27 UTSW 1 166099454 missense probably benign 0.00
R6222:Dusp27 UTSW 1 166098645 missense probably benign 0.26
R6239:Dusp27 UTSW 1 166098819 missense probably damaging 1.00
R6531:Dusp27 UTSW 1 166110046 splice site probably null
R6586:Dusp27 UTSW 1 166100885 missense possibly damaging 0.79
R7006:Dusp27 UTSW 1 166099094 missense probably benign
R7111:Dusp27 UTSW 1 166127154 missense possibly damaging 0.66
R7310:Dusp27 UTSW 1 166098731 missense possibly damaging 0.46
R7312:Dusp27 UTSW 1 166127107 missense probably damaging 0.99
R7378:Dusp27 UTSW 1 166112063 nonsense probably null
R7398:Dusp27 UTSW 1 166100475 missense probably damaging 1.00
R7442:Dusp27 UTSW 1 166101015 missense probably benign 0.01
R7569:Dusp27 UTSW 1 166108035 missense probably damaging 1.00
Z1088:Dusp27 UTSW 1 166099283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTTCCTGCCCTTAATAGTGG -3'
(R):5'- TGCCTCTTGTTCCAGAAGC -3'

Sequencing Primer
(F):5'- CCTTAATAGTGGCCCACAGAGTG -3'
(R):5'- CTCTTGTTCCAGAAGCGTGGC -3'
Posted On2018-11-28