Incidental Mutation 'R6958:Slc26a7'
ID541572
Institutional Source Beutler Lab
Gene Symbol Slc26a7
Ensembl Gene ENSMUSG00000040569
Gene Namesolute carrier family 26, member 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6958 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location14502430-14621805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14506442 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 636 (A636T)
Ref Sequence ENSEMBL: ENSMUSP00000041789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042221]
Predicted Effect probably benign
Transcript: ENSMUST00000042221
AA Change: A636T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000041789
Gene: ENSMUSG00000040569
AA Change: A636T

DomainStartEndE-ValueType
Pfam:Sulfate_transp 47 444 6.9e-95 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Pfam:STAS 493 637 4.7e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in gene structure and protein length yet have markedly different tissue expression patterns. This gene has abundant and specific expression in the kidney. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice deficient for this marker have a reduce arterial pH and reduced serum bicarbonate. Urine is more concentrated and has an elevated pH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,943,803 D159G probably benign Het
Ahnak A G 19: 9,015,215 N4621S possibly damaging Het
Ankrd16 C T 2: 11,779,793 A144V probably damaging Het
BC080695 A T 4: 143,571,259 D83V probably damaging Het
Ccdc14 T C 16: 34,690,806 V2A probably damaging Het
Ccdc187 C T 2: 26,289,719 V243I probably benign Het
Cdk12 A T 11: 98,241,699 I985F unknown Het
Cfap65 T C 1: 74,931,899 T87A possibly damaging Het
Cilp2 G A 8: 69,882,540 P603S probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cpa6 C T 1: 10,595,688 V42M probably damaging Het
Cpsf4 A G 5: 145,175,592 I115V probably benign Het
Dnah11 G T 12: 117,933,809 P3562Q probably damaging Het
Dnah9 A G 11: 66,076,341 F1664L probably damaging Het
Dpysl3 T C 18: 43,438,002 Q69R probably benign Het
Dusp27 T A 1: 166,107,996 D211V probably damaging Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Eif2ak3 T A 6: 70,892,683 C785S probably benign Het
Elk4 T A 1: 132,017,832 F149L probably damaging Het
Fgf14 A G 14: 124,676,597 W41R probably benign Het
Fmnl1 T A 11: 103,171,314 M1K probably null Het
Foxk2 A T 11: 121,299,737 Q568L probably benign Het
Fryl T G 5: 73,073,929 I1602L possibly damaging Het
Gfm2 A G 13: 97,146,236 I75V probably damaging Het
Gm3233 T A 10: 77,759,535 probably benign Het
Gm5096 G A 18: 87,756,922 E190K probably benign Het
Gnb1 G T 4: 155,543,194 probably null Het
Gphn G T 12: 78,680,299 V662L possibly damaging Het
Il3 A C 11: 54,267,111 V47G probably benign Het
Iqgap3 A G 3: 88,113,366 D401G possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Krtap6-2 A G 16: 89,419,810 S90P unknown Het
Lars C T 18: 42,236,639 V394I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp10 A G 14: 54,469,821 probably benign Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Lzts2 G T 19: 45,024,143 probably benign Het
Msantd2 A G 9: 37,523,457 E331G probably damaging Het
Myo15 G A 11: 60,503,625 G1218S probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nhp2 A G 11: 51,623,107 T118A probably benign Het
Nup155 A G 15: 8,147,154 Y972C probably damaging Het
Nxpe2 A T 9: 48,326,266 C230S probably damaging Het
Olfr103 T C 17: 37,336,417 I272V probably benign Het
Olfr1151 T C 2: 87,857,951 Y259H probably damaging Het
Olfr577 A G 7: 102,973,884 L36P possibly damaging Het
Pfkfb4 A T 9: 109,010,547 N244I probably damaging Het
Pi4ka C T 16: 17,325,227 R24Q probably damaging Het
Pkd2l2 C A 18: 34,409,490 Y8* probably null Het
Ptprb T A 10: 116,277,248 N44K probably benign Het
Sds G A 5: 120,481,472 V149M probably damaging Het
Slc22a30 A G 19: 8,386,701 F204L probably damaging Het
Slc27a1 C T 8: 71,585,439 A577V possibly damaging Het
Spata13 A T 14: 60,751,851 T319S possibly damaging Het
Tdrd3 A G 14: 87,457,096 D29G probably damaging Het
Tex15 A T 8: 33,570,871 I110L probably benign Het
Treml2 A G 17: 48,308,152 T222A probably damaging Het
Trpd52l3 A T 19: 30,004,146 L100F probably damaging Het
Ttf2 C T 3: 100,945,932 E975K probably benign Het
Vmn1r193 T A 13: 22,219,974 probably benign Het
Xpo1 A G 11: 23,285,855 T648A probably benign Het
Zfp641 C T 15: 98,292,951 V71I possibly damaging Het
Other mutations in Slc26a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Slc26a7 APN 4 14548403 splice site probably benign
IGL00943:Slc26a7 APN 4 14506477 missense probably benign 0.01
IGL01878:Slc26a7 APN 4 14519388 splice site probably null
IGL02698:Slc26a7 APN 4 14593867 missense possibly damaging 0.93
IGL03133:Slc26a7 APN 4 14532576 missense possibly damaging 0.49
R0200:Slc26a7 UTSW 4 14621317 missense probably benign 0.04
R0240:Slc26a7 UTSW 4 14532651 missense probably damaging 1.00
R0240:Slc26a7 UTSW 4 14532651 missense probably damaging 1.00
R0608:Slc26a7 UTSW 4 14621317 missense probably benign 0.04
R0833:Slc26a7 UTSW 4 14593873 missense probably damaging 1.00
R1496:Slc26a7 UTSW 4 14506489 missense probably benign 0.01
R1592:Slc26a7 UTSW 4 14552470 missense probably benign 0.09
R1656:Slc26a7 UTSW 4 14621221 missense possibly damaging 0.90
R1758:Slc26a7 UTSW 4 14548491 missense possibly damaging 0.58
R1861:Slc26a7 UTSW 4 14522873 missense probably benign
R2429:Slc26a7 UTSW 4 14506399 splice site probably benign
R2850:Slc26a7 UTSW 4 14593806 splice site probably benign
R3442:Slc26a7 UTSW 4 14565511 missense probably benign 0.11
R4158:Slc26a7 UTSW 4 14544197 missense probably benign 0.38
R4160:Slc26a7 UTSW 4 14544197 missense probably benign 0.38
R4721:Slc26a7 UTSW 4 14510261 splice site probably null
R4727:Slc26a7 UTSW 4 14590477 missense probably damaging 1.00
R4825:Slc26a7 UTSW 4 14546309 missense probably benign 0.18
R4992:Slc26a7 UTSW 4 14565508 missense probably damaging 1.00
R5024:Slc26a7 UTSW 4 14532572 missense possibly damaging 0.91
R5344:Slc26a7 UTSW 4 14519402 missense probably benign 0.00
R5373:Slc26a7 UTSW 4 14546447 missense probably damaging 0.99
R5540:Slc26a7 UTSW 4 14506621 missense probably benign
R6046:Slc26a7 UTSW 4 14505471 missense probably benign 0.24
R6320:Slc26a7 UTSW 4 14524498 missense probably benign 0.01
R6685:Slc26a7 UTSW 4 14593819 missense probably damaging 1.00
R6685:Slc26a7 UTSW 4 14593820 missense probably damaging 1.00
R6880:Slc26a7 UTSW 4 14516159 missense possibly damaging 0.57
R7000:Slc26a7 UTSW 4 14552476 missense probably benign
R7090:Slc26a7 UTSW 4 14565460 nonsense probably null
R7122:Slc26a7 UTSW 4 14533639 missense probably damaging 1.00
R7361:Slc26a7 UTSW 4 14546305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATAACTTGCCCACCAAATG -3'
(R):5'- AGCCAACTGTACTGGTAAGACG -3'

Sequencing Primer
(F):5'- CACCAAATGGAATGGAATCATTTC -3'
(R):5'- AAGACGGTGTTGTCAGCTACCATC -3'
Posted On2018-11-28