Incidental Mutation 'R6958:Ptprb'
ID541589
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6958 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116277248 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 44 (N44K)
Ref Sequence ENSEMBL: ENSMUSP00000151821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063470] [ENSMUST00000105271] [ENSMUST00000128399] [ENSMUST00000148731] [ENSMUST00000155606] [ENSMUST00000218553]
Predicted Effect probably benign
Transcript: ENSMUST00000063470
SMART Domains Protein: ENSMUSP00000064392
Gene: ENSMUSG00000020151

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
PTPc 391 648 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105271
SMART Domains Protein: ENSMUSP00000100907
Gene: ENSMUSG00000020151

DomainStartEndE-ValueType
transmembrane domain 119 141 N/A INTRINSIC
PTPc 284 541 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128399
SMART Domains Protein: ENSMUSP00000114455
Gene: ENSMUSG00000020151

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148731
SMART Domains Protein: ENSMUSP00000120965
Gene: ENSMUSG00000020151

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155606
SMART Domains Protein: ENSMUSP00000122259
Gene: ENSMUSG00000020151

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218553
AA Change: N44K

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,943,803 D159G probably benign Het
Ahnak A G 19: 9,015,215 N4621S possibly damaging Het
Ankrd16 C T 2: 11,779,793 A144V probably damaging Het
BC080695 A T 4: 143,571,259 D83V probably damaging Het
Ccdc14 T C 16: 34,690,806 V2A probably damaging Het
Ccdc187 C T 2: 26,289,719 V243I probably benign Het
Cdk12 A T 11: 98,241,699 I985F unknown Het
Cfap65 T C 1: 74,931,899 T87A possibly damaging Het
Cilp2 G A 8: 69,882,540 P603S probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cpa6 C T 1: 10,595,688 V42M probably damaging Het
Cpsf4 A G 5: 145,175,592 I115V probably benign Het
Dnah11 G T 12: 117,933,809 P3562Q probably damaging Het
Dnah9 A G 11: 66,076,341 F1664L probably damaging Het
Dpysl3 T C 18: 43,438,002 Q69R probably benign Het
Dusp27 T A 1: 166,107,996 D211V probably damaging Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Eif2ak3 T A 6: 70,892,683 C785S probably benign Het
Elk4 T A 1: 132,017,832 F149L probably damaging Het
Fgf14 A G 14: 124,676,597 W41R probably benign Het
Fmnl1 T A 11: 103,171,314 M1K probably null Het
Foxk2 A T 11: 121,299,737 Q568L probably benign Het
Fryl T G 5: 73,073,929 I1602L possibly damaging Het
Gfm2 A G 13: 97,146,236 I75V probably damaging Het
Gm3233 T A 10: 77,759,535 probably benign Het
Gm5096 G A 18: 87,756,922 E190K probably benign Het
Gnb1 G T 4: 155,543,194 probably null Het
Gphn G T 12: 78,680,299 V662L possibly damaging Het
Il3 A C 11: 54,267,111 V47G probably benign Het
Iqgap3 A G 3: 88,113,366 D401G possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Krtap6-2 A G 16: 89,419,810 S90P unknown Het
Lars C T 18: 42,236,639 V394I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp10 A G 14: 54,469,821 probably benign Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Lzts2 G T 19: 45,024,143 probably benign Het
Msantd2 A G 9: 37,523,457 E331G probably damaging Het
Myo15 G A 11: 60,503,625 G1218S probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nhp2 A G 11: 51,623,107 T118A probably benign Het
Nup155 A G 15: 8,147,154 Y972C probably damaging Het
Nxpe2 A T 9: 48,326,266 C230S probably damaging Het
Olfr103 T C 17: 37,336,417 I272V probably benign Het
Olfr1151 T C 2: 87,857,951 Y259H probably damaging Het
Olfr577 A G 7: 102,973,884 L36P possibly damaging Het
Pfkfb4 A T 9: 109,010,547 N244I probably damaging Het
Pi4ka C T 16: 17,325,227 R24Q probably damaging Het
Pkd2l2 C A 18: 34,409,490 Y8* probably null Het
Sds G A 5: 120,481,472 V149M probably damaging Het
Slc22a30 A G 19: 8,386,701 F204L probably damaging Het
Slc26a7 C T 4: 14,506,442 A636T probably benign Het
Slc27a1 C T 8: 71,585,439 A577V possibly damaging Het
Spata13 A T 14: 60,751,851 T319S possibly damaging Het
Tdrd3 A G 14: 87,457,096 D29G probably damaging Het
Tex15 A T 8: 33,570,871 I110L probably benign Het
Treml2 A G 17: 48,308,152 T222A probably damaging Het
Trpd52l3 A T 19: 30,004,146 L100F probably damaging Het
Ttf2 C T 3: 100,945,932 E975K probably benign Het
Vmn1r193 T A 13: 22,219,974 probably benign Het
Xpo1 A G 11: 23,285,855 T648A probably benign Het
Zfp641 C T 15: 98,292,951 V71I possibly damaging Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GTCATGTGAGCTAAATCTGAGACTG -3'
(R):5'- AAACCTTCCTGAGCATGGCAG -3'

Sequencing Primer
(F):5'- TGTTCACTTGCCACGCTAGAAAG -3'
(R):5'- GCAGGTCCATCGGGGTG -3'
Posted On2018-11-28