Incidental Mutation 'R0606:Nf2'
ID54160
Institutional Source Beutler Lab
Gene Symbol Nf2
Ensembl Gene ENSMUSG00000009073
Gene Nameneurofibromin 2
Synonymsmoesin-ezrin-radixin-like protein, merlin, schwannomin
MMRRC Submission 038795-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0606 (G1)
Quality Score201
Status Validated
Chromosome11
Chromosomal Location4765845-4849536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4782194 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 507 (I507T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053079] [ENSMUST00000056290] [ENSMUST00000109910] [ENSMUST00000152656]
Predicted Effect probably benign
Transcript: ENSMUST00000053079
AA Change: I578T

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055033
Gene: ENSMUSG00000009073
AA Change: I578T

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 585 6.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056290
AA Change: I578T

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055061
Gene: ENSMUSG00000009073
AA Change: I578T

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 585 6.3e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000093374
AA Change: I507T

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091066
Gene: ENSMUSG00000009073
AA Change: I507T

DomainStartEndE-ValueType
B41 2 152 2.21e-33 SMART
FERM_C 156 245 1.08e-30 SMART
Pfam:ERM 277 515 1.7e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109908
Predicted Effect probably benign
Transcript: ENSMUST00000109910
AA Change: I578T

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105536
Gene: ENSMUSG00000009073
AA Change: I578T

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 596 5.5e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141342
Predicted Effect probably benign
Transcript: ENSMUST00000152656
SMART Domains Protein: ENSMUSP00000128494
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
Blast:B41 1 28 2e-9 BLAST
PDB:1E5W|A 1 28 7e-6 PDB
FERM_C 29 118 1.08e-30 SMART
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to some members of the ERM (ezrin, radixin, moesin) family of proteins that are thought to link cytoskeletal components with proteins in the cell membrane. This gene product has been shown to interact with cell-surface proteins, proteins involved in cytoskeletal dynamics and proteins involved in regulating ion transport. This gene is expressed at high levels during embryonic development; in adults, significant expression is found in Schwann cells, meningeal cells, lens and nerve. Mutations in this gene are associated with neurofibromatosis type II which is characterized by nervous system and skin tumors and ocular abnormalities. Two predominant isoforms and a number of minor isoforms are produced by alternatively spliced transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants lack extraembryonic ectoderm, do not initiate gastrulation and die by embryonic day 7. Heterozygotes develop malignant tumors, especially osteosarcomas. Conditional Schwann cell knockouts resemble neurofibromatosis type 2. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,259,089 Y128H probably damaging Het
Actl9 T C 17: 33,433,598 Y211H probably damaging Het
Actn1 A T 12: 80,174,647 probably benign Het
Adtrp A G 13: 41,767,405 F197L probably damaging Het
Ankrd11 G A 8: 122,892,832 T1406I probably benign Het
Arhgap24 A T 5: 102,897,220 R620W probably damaging Het
Atg13 A G 2: 91,682,073 Y284H probably benign Het
Atrn A G 2: 130,906,856 E99G possibly damaging Het
Cage1 A T 13: 38,016,494 probably benign Het
Ccr3 T A 9: 124,028,802 M58K probably benign Het
Cdk18 G T 1: 132,117,617 probably benign Het
Chst5 A G 8: 111,890,919 V23A probably benign Het
Col4a3 T C 1: 82,672,586 probably benign Het
Col4a6 A G X: 141,192,223 probably benign Het
Csmd3 T C 15: 48,457,662 I251V probably benign Het
Csnk1g3 G A 18: 53,917,028 V115M probably damaging Het
Cst7 A T 2: 150,570,519 M1L probably benign Het
Cyp4f17 A T 17: 32,527,843 D373V probably damaging Het
Dclk2 G A 3: 86,906,004 R212W probably damaging Het
Dhrs7b T G 11: 60,830,746 probably benign Het
Dhx58 T A 11: 100,702,251 H210L probably benign Het
Dnah9 T C 11: 65,841,333 Y4249C probably damaging Het
Eif5b T A 1: 38,048,893 L990H probably damaging Het
Faap24 T C 7: 35,394,963 probably benign Het
Fryl T A 5: 73,124,734 H174L probably benign Het
Gabrr1 T C 4: 33,132,696 W15R probably benign Het
Gif A T 19: 11,752,294 I206F possibly damaging Het
Gm15446 T C 5: 109,943,481 V533A probably benign Het
Gm6760 T A X: 64,151,653 K63* probably null Het
Gne C T 4: 44,042,244 E444K possibly damaging Het
Gpr173 T A X: 152,347,040 M146L possibly damaging Het
Hira C T 16: 18,935,047 S547L probably benign Het
Hnf1b A G 11: 83,863,984 H161R probably benign Het
Hnrnpm T A 17: 33,658,390 N53I probably damaging Het
Hs3st5 A T 10: 36,832,588 I40F probably benign Het
Hydin C T 8: 110,549,798 probably benign Het
Ift172 A G 5: 31,254,313 I1607T probably damaging Het
Igfn1 T C 1: 135,959,901 Q2475R probably damaging Het
Il6st T C 13: 112,504,272 S800P possibly damaging Het
Iqub G A 6: 24,501,261 probably benign Het
Itgb1 A T 8: 128,722,372 probably benign Het
Kctd21 G A 7: 97,347,601 E94K probably benign Het
Kir3dl2 A G X: 136,453,511 V233A possibly damaging Het
Klra2 A T 6: 131,220,224 C271S probably damaging Het
Lacc1 A T 14: 77,029,621 C401S probably damaging Het
Lmna T C 3: 88,482,578 E580G probably damaging Het
Matn2 A G 15: 34,345,150 Y101C probably damaging Het
Mrps16 G A 14: 20,391,389 R116* probably null Het
Ndrg2 G T 14: 51,906,217 R333S probably damaging Het
Nktr A G 9: 121,749,290 probably benign Het
Nkx3-1 G A 14: 69,191,006 probably benign Het
Npat T C 9: 53,556,481 probably null Het
Nrxn1 T C 17: 90,565,373 N1047S probably damaging Het
Nup210 A T 6: 91,026,929 I1402N possibly damaging Het
Olfr1168 G T 2: 88,185,280 M134I possibly damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdcl2 C T 5: 76,312,481 S182N probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pla2g4a A G 1: 149,840,704 F669L probably benign Het
Plekha8 A G 6: 54,629,820 K367E probably damaging Het
Pola1 A G X: 93,488,087 probably benign Het
Ppm1d C T 11: 85,345,877 T494I probably benign Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prl6a1 A T 13: 27,314,194 probably benign Het
Ptprg T A 14: 12,154,131 S617R probably benign Het
R3hdm2 G A 10: 127,444,444 G45D probably damaging Het
Rev1 T A 1: 38,059,123 R780W probably null Het
Rnf139 T A 15: 58,899,827 F567Y probably damaging Het
Scarf1 T C 11: 75,514,348 V71A probably damaging Het
Shtn1 A G 19: 58,999,940 S438P probably damaging Het
Slc30a3 T A 5: 31,088,723 H221L probably benign Het
Smo A C 6: 29,753,604 I160L possibly damaging Het
Snapc5 A T 9: 64,179,300 probably benign Het
Snf8 G T 11: 96,034,973 probably benign Het
Spata31d1a T C 13: 59,702,431 S628G probably benign Het
Sphkap A T 1: 83,280,424 D199E probably damaging Het
Stxbp5l T C 16: 37,204,521 T572A possibly damaging Het
Thada C A 17: 84,416,303 V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 Q735R probably benign Het
Tmem29 C T X: 150,398,364 A144T probably benign Het
Trim24 G A 6: 37,871,234 E42K probably benign Het
Trnt1 T A 6: 106,777,908 probably benign Het
Ttbk2 A T 2: 120,773,872 M215K probably damaging Het
Ttc8 C T 12: 98,943,459 probably benign Het
Ube3c A G 5: 29,590,928 Y105C probably damaging Het
Unc13c A G 9: 73,530,983 probably benign Het
Usp36 A G 11: 118,263,028 probably benign Het
Vmn2r102 T C 17: 19,678,844 S483P possibly damaging Het
Wdr95 A G 5: 149,588,130 T432A probably damaging Het
Wnk1 G T 6: 119,926,683 P2523H probably damaging Het
Xpo4 A G 14: 57,638,208 probably benign Het
Zar1 G T 5: 72,580,543 P71Q probably damaging Het
Zbtb41 T C 1: 139,423,610 Y154H probably benign Het
Zer1 G T 2: 30,104,797 probably benign Het
Zfp454 A G 11: 50,874,185 F140S probably benign Het
Other mutations in Nf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Nf2 APN 11 4791123 missense probably benign 0.00
IGL01072:Nf2 APN 11 4789713 missense probably null 0.00
IGL01349:Nf2 APN 11 4784472 missense possibly damaging 0.94
IGL01686:Nf2 APN 11 4818613 missense probably benign
IGL01820:Nf2 APN 11 4789655 unclassified probably null
IGL02251:Nf2 APN 11 4848873 missense probably null 1.00
IGL02755:Nf2 APN 11 4818542 missense probably damaging 1.00
IGL02859:Nf2 APN 11 4791209 missense probably damaging 1.00
R0331:Nf2 UTSW 11 4794914 missense probably benign 0.21
R0513:Nf2 UTSW 11 4791185 missense possibly damaging 0.56
R0734:Nf2 UTSW 11 4820409 missense probably benign 0.00
R1749:Nf2 UTSW 11 4803694 missense possibly damaging 0.60
R2192:Nf2 UTSW 11 4799899 missense probably damaging 1.00
R4073:Nf2 UTSW 11 4848958 missense probably benign 0.27
R4355:Nf2 UTSW 11 4780613 nonsense probably null
R4629:Nf2 UTSW 11 4848915 missense probably damaging 0.99
R5129:Nf2 UTSW 11 4816145 missense probably benign
R5130:Nf2 UTSW 11 4829862 intron probably benign
R5580:Nf2 UTSW 11 4803689 missense probably damaging 1.00
R5599:Nf2 UTSW 11 4782269 missense probably damaging 1.00
R5840:Nf2 UTSW 11 4816146 missense probably benign 0.24
R6017:Nf2 UTSW 11 4816137 missense possibly damaging 0.95
R6029:Nf2 UTSW 11 4784566 splice site probably null
R6230:Nf2 UTSW 11 4808262 missense possibly damaging 0.81
R6897:Nf2 UTSW 11 4799878 missense probably damaging 1.00
R6990:Nf2 UTSW 11 4799944 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCTTACACAAAGATGGAAGGGACGC -3'
(R):5'- GTTGCACCAGAGTGGAGTACATGG -3'

Sequencing Primer
(F):5'- TGACGCCTTGGGCATAAGTC -3'
(R):5'- TACATGGAGAAGAGCAAGCACC -3'
Posted On2013-07-11