Incidental Mutation 'R6958:Pkd2l2'
ID541615
Institutional Source Beutler Lab
Gene Symbol Pkd2l2
Ensembl Gene ENSMUSG00000014503
Gene Namepolycystic kidney disease 2-like 2
SynonymsTRPP5, Polycystin - L2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6958 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location34409423-34442789 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 34409490 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 8 (Y8*)
Ref Sequence ENSEMBL: ENSMUSP00000127257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014647] [ENSMUST00000166156]
Predicted Effect probably null
Transcript: ENSMUST00000014647
AA Change: Y8*
SMART Domains Protein: ENSMUSP00000014647
Gene: ENSMUSG00000014503
AA Change: Y8*

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.8e-129 PFAM
Pfam:Ion_trans 281 490 4.1e-19 PFAM
coiled coil region 523 550 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166156
AA Change: Y8*
SMART Domains Protein: ENSMUSP00000127257
Gene: ENSMUSG00000014503
AA Change: Y8*

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.6e-131 PFAM
Pfam:Ion_trans 242 502 4.8e-20 PFAM
coiled coil region 523 550 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted gene disruption display hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,943,803 D159G probably benign Het
Ahnak A G 19: 9,015,215 N4621S possibly damaging Het
Ankrd16 C T 2: 11,779,793 A144V probably damaging Het
BC080695 A T 4: 143,571,259 D83V probably damaging Het
Ccdc14 T C 16: 34,690,806 V2A probably damaging Het
Ccdc187 C T 2: 26,289,719 V243I probably benign Het
Cdk12 A T 11: 98,241,699 I985F unknown Het
Cfap65 T C 1: 74,931,899 T87A possibly damaging Het
Cilp2 G A 8: 69,882,540 P603S probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cpa6 C T 1: 10,595,688 V42M probably damaging Het
Cpsf4 A G 5: 145,175,592 I115V probably benign Het
Dnah11 G T 12: 117,933,809 P3562Q probably damaging Het
Dnah9 A G 11: 66,076,341 F1664L probably damaging Het
Dpysl3 T C 18: 43,438,002 Q69R probably benign Het
Dusp27 T A 1: 166,107,996 D211V probably damaging Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Eif2ak3 T A 6: 70,892,683 C785S probably benign Het
Elk4 T A 1: 132,017,832 F149L probably damaging Het
Fgf14 A G 14: 124,676,597 W41R probably benign Het
Fmnl1 T A 11: 103,171,314 M1K probably null Het
Foxk2 A T 11: 121,299,737 Q568L probably benign Het
Fryl T G 5: 73,073,929 I1602L possibly damaging Het
Gfm2 A G 13: 97,146,236 I75V probably damaging Het
Gm3233 T A 10: 77,759,535 probably benign Het
Gm5096 G A 18: 87,756,922 E190K probably benign Het
Gnb1 G T 4: 155,543,194 probably null Het
Gphn G T 12: 78,680,299 V662L possibly damaging Het
Il3 A C 11: 54,267,111 V47G probably benign Het
Iqgap3 A G 3: 88,113,366 D401G possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Krtap6-2 A G 16: 89,419,810 S90P unknown Het
Lars C T 18: 42,236,639 V394I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp10 A G 14: 54,469,821 probably benign Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Lzts2 G T 19: 45,024,143 probably benign Het
Msantd2 A G 9: 37,523,457 E331G probably damaging Het
Myo15 G A 11: 60,503,625 G1218S probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nhp2 A G 11: 51,623,107 T118A probably benign Het
Nup155 A G 15: 8,147,154 Y972C probably damaging Het
Nxpe2 A T 9: 48,326,266 C230S probably damaging Het
Olfr103 T C 17: 37,336,417 I272V probably benign Het
Olfr1151 T C 2: 87,857,951 Y259H probably damaging Het
Olfr577 A G 7: 102,973,884 L36P possibly damaging Het
Pfkfb4 A T 9: 109,010,547 N244I probably damaging Het
Pi4ka C T 16: 17,325,227 R24Q probably damaging Het
Ptprb T A 10: 116,277,248 N44K probably benign Het
Sds G A 5: 120,481,472 V149M probably damaging Het
Slc22a30 A G 19: 8,386,701 F204L probably damaging Het
Slc26a7 C T 4: 14,506,442 A636T probably benign Het
Slc27a1 C T 8: 71,585,439 A577V possibly damaging Het
Spata13 A T 14: 60,751,851 T319S possibly damaging Het
Tdrd3 A G 14: 87,457,096 D29G probably damaging Het
Tex15 A T 8: 33,570,871 I110L probably benign Het
Treml2 A G 17: 48,308,152 T222A probably damaging Het
Trpd52l3 A T 19: 30,004,146 L100F probably damaging Het
Ttf2 C T 3: 100,945,932 E975K probably benign Het
Vmn1r193 T A 13: 22,219,974 probably benign Het
Xpo1 A G 11: 23,285,855 T648A probably benign Het
Zfp641 C T 15: 98,292,951 V71I possibly damaging Het
Other mutations in Pkd2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Pkd2l2 APN 18 34417015 missense probably damaging 1.00
IGL01943:Pkd2l2 APN 18 34417036 missense probably damaging 1.00
IGL02039:Pkd2l2 APN 18 34435368 critical splice donor site probably null
IGL02139:Pkd2l2 APN 18 34412715 nonsense probably null
IGL02480:Pkd2l2 APN 18 34438790 missense possibly damaging 0.48
IGL02742:Pkd2l2 APN 18 34416917 nonsense probably null
IGL02818:Pkd2l2 APN 18 34412809 missense probably damaging 0.97
IGL03218:Pkd2l2 APN 18 34430320 missense probably damaging 1.00
IGL03345:Pkd2l2 APN 18 34425089 missense probably damaging 1.00
R0362:Pkd2l2 UTSW 18 34435327 missense probably benign 0.03
R0627:Pkd2l2 UTSW 18 34425102 missense probably damaging 1.00
R0883:Pkd2l2 UTSW 18 34430268 synonymous probably null
R0973:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R0973:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R0974:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R1199:Pkd2l2 UTSW 18 34438216 critical splice donor site probably null
R1529:Pkd2l2 UTSW 18 34430702 missense probably damaging 1.00
R1579:Pkd2l2 UTSW 18 34427393 missense possibly damaging 0.49
R2229:Pkd2l2 UTSW 18 34430329 missense probably damaging 1.00
R3695:Pkd2l2 UTSW 18 34438790 missense possibly damaging 0.48
R4058:Pkd2l2 UTSW 18 34428192 missense probably benign 0.22
R4600:Pkd2l2 UTSW 18 34438201 missense probably benign 0.03
R4651:Pkd2l2 UTSW 18 34409836 nonsense probably null
R4652:Pkd2l2 UTSW 18 34409836 nonsense probably null
R5114:Pkd2l2 UTSW 18 34433302 missense probably benign
R5341:Pkd2l2 UTSW 18 34409934 intron probably null
R5686:Pkd2l2 UTSW 18 34425237 missense probably damaging 1.00
R5920:Pkd2l2 UTSW 18 34430773 missense probably benign
R6061:Pkd2l2 UTSW 18 34430689 missense probably damaging 1.00
R6167:Pkd2l2 UTSW 18 34428244 missense probably damaging 1.00
R6217:Pkd2l2 UTSW 18 34414680 missense probably benign 0.03
R6293:Pkd2l2 UTSW 18 34427444 missense probably damaging 1.00
R6572:Pkd2l2 UTSW 18 34438771 missense probably damaging 0.99
R6574:Pkd2l2 UTSW 18 34425081 missense probably damaging 1.00
R6723:Pkd2l2 UTSW 18 34438157 missense probably damaging 0.98
R6941:Pkd2l2 UTSW 18 34416883 missense probably benign 0.02
R7052:Pkd2l2 UTSW 18 34425159 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AACTCTCAGGAGGTGAAGCG -3'
(R):5'- TGGCTCCAGATGTAGCTAGC -3'

Sequencing Primer
(F):5'- GTTAGCACTCTGAGGCA -3'
(R):5'- CTCCAGATGTAGCTAGCGGTCAAG -3'
Posted On2018-11-28