Incidental Mutation 'R6960:Olfr1289'
ID541691
Institutional Source Beutler Lab
Gene Symbol Olfr1289
Ensembl Gene ENSMUSG00000061195
Gene Nameolfactory receptor 1289
SynonymsGA_x6K02T2Q125-72534883-72535821, MOR245-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6960 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111480819-111484615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111483726 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 127 (V127I)
Ref Sequence ENSEMBL: ENSMUSP00000146801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816] [ENSMUST00000217611]
Predicted Effect probably benign
Transcript: ENSMUST00000104889
SMART Domains Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-43 PFAM
Pfam:7tm_1 41 287 2.5e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120021
AA Change: V127I

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207494
AA Change: V99I

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000214816
Predicted Effect probably benign
Transcript: ENSMUST00000217611
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,072,924 D1170G probably benign Het
Ak7 A T 12: 105,710,244 T68S probably benign Het
Arhgap12 A T 18: 6,111,901 N26K probably damaging Het
B3galt1 A T 2: 68,118,689 E249D probably damaging Het
Catsper4 T A 4: 134,227,337 M1L probably benign Het
Cc2d2b T C 19: 40,785,062 V523A possibly damaging Het
Cyp11a1 T C 9: 58,018,376 F98S probably damaging Het
Cyp2d26 T C 15: 82,790,245 S479G probably damaging Het
Dclre1a T G 19: 56,542,709 Y735S probably damaging Het
Dio2 C T 12: 90,729,897 G106R probably damaging Het
Efcab12 T C 6: 115,838,312 probably benign Het
Ehhadh C A 16: 21,762,278 V655L probably benign Het
Ercc2 G A 7: 19,393,690 R379Q probably damaging Het
Fabp4 A G 3: 10,208,477 V12A probably benign Het
Fbn1 T C 2: 125,382,060 I590V probably benign Het
Grm8 C A 6: 27,981,282 V210L probably damaging Het
Jakmip3 A G 7: 139,023,336 D359G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Ly75 A T 2: 60,306,405 Y1493N probably benign Het
Lyst A G 13: 13,634,078 N111S probably benign Het
Lyz2 G C 10: 117,278,702 I107M possibly damaging Het
Mgat5 A T 1: 127,320,634 D91V possibly damaging Het
Mical3 T A 6: 120,958,543 D1674V probably damaging Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Naa16 A G 14: 79,359,471 Y358H possibly damaging Het
Nktr T A 9: 121,742,692 H226Q probably damaging Het
Ocln T G 13: 100,498,872 K503T possibly damaging Het
Olfm4 T C 14: 80,021,314 L301S probably damaging Het
Olfr821 T C 10: 130,034,103 L159P probably benign Het
Paqr4 G A 17: 23,737,723 A222V probably benign Het
Pcdhb13 A G 18: 37,443,456 T296A probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Pigg T C 5: 108,326,841 V309A probably damaging Het
Ptger4 T C 15: 5,234,715 R462G probably benign Het
Ptprc C T 1: 138,078,445 probably null Het
Rabggta A C 14: 55,721,842 probably null Het
Rnf25 A G 1: 74,595,244 S207P possibly damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Rtf1 A G 2: 119,711,078 Q264R probably damaging Het
Ryr2 A G 13: 11,801,243 V619A probably benign Het
Serpinb6d A G 13: 33,671,198 N285S probably benign Het
Slamf6 A G 1: 171,917,753 M16V probably damaging Het
Slc22a23 A G 13: 34,344,157 probably null Het
Slc23a2 T C 2: 132,091,253 D95G probably damaging Het
Smc3 T C 19: 53,629,371 Y600H probably damaging Het
Tarbp1 G A 8: 126,429,039 T1320M possibly damaging Het
Tigd4 A T 3: 84,594,116 K113N probably damaging Het
Tjp1 A T 7: 65,303,015 F1444I possibly damaging Het
Tstd3 A T 4: 21,767,118 M1K probably null Het
Wisp1 C T 15: 66,919,198 T283M probably benign Het
Zbtb46 T C 2: 181,423,424 D311G probably damaging Het
Other mutations in Olfr1289
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr1289 APN 2 111484101 missense probably damaging 1.00
IGL01682:Olfr1289 APN 2 111483843 missense probably damaging 1.00
IGL02028:Olfr1289 APN 2 111483471 missense probably benign 0.01
IGL02731:Olfr1289 APN 2 111483528 missense probably benign 0.00
IGL03035:Olfr1289 APN 2 111483823 missense probably benign 0.04
R1214:Olfr1289 UTSW 2 111483892 missense probably damaging 1.00
R1471:Olfr1289 UTSW 2 111484006 missense probably damaging 1.00
R1714:Olfr1289 UTSW 2 111483663 missense probably damaging 1.00
R2088:Olfr1289 UTSW 2 111484278 missense probably damaging 1.00
R2136:Olfr1289 UTSW 2 111483616 missense probably damaging 1.00
R2141:Olfr1289 UTSW 2 111483630 missense probably benign 0.23
R3945:Olfr1289 UTSW 2 111483687 nonsense probably null
R4276:Olfr1289 UTSW 2 111483504 missense probably damaging 1.00
R4562:Olfr1289 UTSW 2 111483564 missense probably benign 0.00
R4896:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R4946:Olfr1289 UTSW 2 111483966 missense possibly damaging 0.93
R5004:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R5686:Olfr1289 UTSW 2 111484143 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTGTGTTTGGAAACCTTC -3'
(R):5'- ACCACAGAAGGGTAAGCTTATAGC -3'

Sequencing Primer
(F):5'- TGTCATAACTGTGACCAATGACTCC -3'
(R):5'- GCTTATAGCAAAGGCCAATTGG -3'
Posted On2018-11-28