Incidental Mutation 'R0606:Il6st'
ID54173
Institutional Source Beutler Lab
Gene Symbol Il6st
Ensembl Gene ENSMUSG00000021756
Gene Nameinterleukin 6 signal transducer
SynonymsD13Ertd699e, gp130, CD130, 5133400A03Rik
MMRRC Submission 038795-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0606 (G1)
Quality Score215
Status Validated
Chromosome13
Chromosomal Location112464070-112510086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112504272 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 800 (S800P)
Ref Sequence ENSEMBL: ENSMUSP00000138915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070731] [ENSMUST00000183513] [ENSMUST00000183663] [ENSMUST00000183829] [ENSMUST00000184276] [ENSMUST00000184311] [ENSMUST00000184445] [ENSMUST00000184949]
Predicted Effect probably benign
Transcript: ENSMUST00000070731
AA Change: S861P

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064205
Gene: ENSMUSG00000021756
AA Change: S861P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 26 112 1.4e-30 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183513
SMART Domains Protein: ENSMUSP00000139016
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183663
AA Change: S861P

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138836
Gene: ENSMUSG00000021756
AA Change: S861P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183829
SMART Domains Protein: ENSMUSP00000138987
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:1I1R|A 23 52 7e-8 PDB
FN3 56 142 7.23e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184276
SMART Domains Protein: ENSMUSP00000139060
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2.3e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184311
AA Change: S861P

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139227
Gene: ENSMUSG00000021756
AA Change: S861P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184445
SMART Domains Protein: ENSMUSP00000139311
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184949
AA Change: S800P

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138915
Gene: ENSMUSG00000021756
AA Change: S800P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 9.4e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 442 6.97e0 SMART
FN3 456 539 4.81e-4 SMART
transmembrane domain 557 579 N/A INTRINSIC
low complexity region 657 692 N/A INTRINSIC
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggest that this gene plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants have been described. A related pseudogene has been identified on chromosome 17. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations show myocardial and hematological defects and die between embryonic day 12.5 and term. Conditional mutants show female infertility and neurological, cardiac, hematopoietic, immunological, hepatic, and lung defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,259,089 Y128H probably damaging Het
Actl9 T C 17: 33,433,598 Y211H probably damaging Het
Actn1 A T 12: 80,174,647 probably benign Het
Adtrp A G 13: 41,767,405 F197L probably damaging Het
Ankrd11 G A 8: 122,892,832 T1406I probably benign Het
Arhgap24 A T 5: 102,897,220 R620W probably damaging Het
Atg13 A G 2: 91,682,073 Y284H probably benign Het
Atrn A G 2: 130,906,856 E99G possibly damaging Het
Cage1 A T 13: 38,016,494 probably benign Het
Ccr3 T A 9: 124,028,802 M58K probably benign Het
Cdk18 G T 1: 132,117,617 probably benign Het
Chst5 A G 8: 111,890,919 V23A probably benign Het
Col4a3 T C 1: 82,672,586 probably benign Het
Col4a6 A G X: 141,192,223 probably benign Het
Csmd3 T C 15: 48,457,662 I251V probably benign Het
Csnk1g3 G A 18: 53,917,028 V115M probably damaging Het
Cst7 A T 2: 150,570,519 M1L probably benign Het
Cyp4f17 A T 17: 32,527,843 D373V probably damaging Het
Dclk2 G A 3: 86,906,004 R212W probably damaging Het
Dhrs7b T G 11: 60,830,746 probably benign Het
Dhx58 T A 11: 100,702,251 H210L probably benign Het
Dnah9 T C 11: 65,841,333 Y4249C probably damaging Het
Eif5b T A 1: 38,048,893 L990H probably damaging Het
Faap24 T C 7: 35,394,963 probably benign Het
Fryl T A 5: 73,124,734 H174L probably benign Het
Gabrr1 T C 4: 33,132,696 W15R probably benign Het
Gif A T 19: 11,752,294 I206F possibly damaging Het
Gm15446 T C 5: 109,943,481 V533A probably benign Het
Gm6760 T A X: 64,151,653 K63* probably null Het
Gne C T 4: 44,042,244 E444K possibly damaging Het
Gpr173 T A X: 152,347,040 M146L possibly damaging Het
Hira C T 16: 18,935,047 S547L probably benign Het
Hnf1b A G 11: 83,863,984 H161R probably benign Het
Hnrnpm T A 17: 33,658,390 N53I probably damaging Het
Hs3st5 A T 10: 36,832,588 I40F probably benign Het
Hydin C T 8: 110,549,798 probably benign Het
Ift172 A G 5: 31,254,313 I1607T probably damaging Het
Igfn1 T C 1: 135,959,901 Q2475R probably damaging Het
Iqub G A 6: 24,501,261 probably benign Het
Itgb1 A T 8: 128,722,372 probably benign Het
Kctd21 G A 7: 97,347,601 E94K probably benign Het
Kir3dl2 A G X: 136,453,511 V233A possibly damaging Het
Klra2 A T 6: 131,220,224 C271S probably damaging Het
Lacc1 A T 14: 77,029,621 C401S probably damaging Het
Lmna T C 3: 88,482,578 E580G probably damaging Het
Matn2 A G 15: 34,345,150 Y101C probably damaging Het
Mrps16 G A 14: 20,391,389 R116* probably null Het
Ndrg2 G T 14: 51,906,217 R333S probably damaging Het
Nf2 A G 11: 4,782,194 I507T possibly damaging Het
Nktr A G 9: 121,749,290 probably benign Het
Nkx3-1 G A 14: 69,191,006 probably benign Het
Npat T C 9: 53,556,481 probably null Het
Nrxn1 T C 17: 90,565,373 N1047S probably damaging Het
Nup210 A T 6: 91,026,929 I1402N possibly damaging Het
Olfr1168 G T 2: 88,185,280 M134I possibly damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdcl2 C T 5: 76,312,481 S182N probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pla2g4a A G 1: 149,840,704 F669L probably benign Het
Plekha8 A G 6: 54,629,820 K367E probably damaging Het
Pola1 A G X: 93,488,087 probably benign Het
Ppm1d C T 11: 85,345,877 T494I probably benign Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prl6a1 A T 13: 27,314,194 probably benign Het
Ptprg T A 14: 12,154,131 S617R probably benign Het
R3hdm2 G A 10: 127,444,444 G45D probably damaging Het
Rev1 T A 1: 38,059,123 R780W probably null Het
Rnf139 T A 15: 58,899,827 F567Y probably damaging Het
Scarf1 T C 11: 75,514,348 V71A probably damaging Het
Shtn1 A G 19: 58,999,940 S438P probably damaging Het
Slc30a3 T A 5: 31,088,723 H221L probably benign Het
Smo A C 6: 29,753,604 I160L possibly damaging Het
Snapc5 A T 9: 64,179,300 probably benign Het
Snf8 G T 11: 96,034,973 probably benign Het
Spata31d1a T C 13: 59,702,431 S628G probably benign Het
Sphkap A T 1: 83,280,424 D199E probably damaging Het
Stxbp5l T C 16: 37,204,521 T572A possibly damaging Het
Thada C A 17: 84,416,303 V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 Q735R probably benign Het
Tmem29 C T X: 150,398,364 A144T probably benign Het
Trim24 G A 6: 37,871,234 E42K probably benign Het
Trnt1 T A 6: 106,777,908 probably benign Het
Ttbk2 A T 2: 120,773,872 M215K probably damaging Het
Ttc8 C T 12: 98,943,459 probably benign Het
Ube3c A G 5: 29,590,928 Y105C probably damaging Het
Unc13c A G 9: 73,530,983 probably benign Het
Usp36 A G 11: 118,263,028 probably benign Het
Vmn2r102 T C 17: 19,678,844 S483P possibly damaging Het
Wdr95 A G 5: 149,588,130 T432A probably damaging Het
Wnk1 G T 6: 119,926,683 P2523H probably damaging Het
Xpo4 A G 14: 57,638,208 probably benign Het
Zar1 G T 5: 72,580,543 P71Q probably damaging Het
Zbtb41 T C 1: 139,423,610 Y154H probably benign Het
Zer1 G T 2: 30,104,797 probably benign Het
Zfp454 A G 11: 50,874,185 F140S probably benign Het
Other mutations in Il6st
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Il6st APN 13 112481433 unclassified probably null
IGL00571:Il6st APN 13 112487860 missense probably damaging 1.00
IGL01151:Il6st APN 13 112493651 missense probably benign 0.00
IGL01336:Il6st APN 13 112480239 missense possibly damaging 0.71
IGL01501:Il6st APN 13 112480059 missense probably benign 0.22
IGL01512:Il6st APN 13 112504366 missense probably benign 0.36
IGL01657:Il6st APN 13 112481543 missense probably damaging 1.00
IGL01863:Il6st APN 13 112504210 missense possibly damaging 0.88
IGL01916:Il6st APN 13 112480072 missense possibly damaging 0.90
IGL01978:Il6st APN 13 112497357 missense possibly damaging 0.51
IGL02089:Il6st APN 13 112495240 missense probably benign 0.12
IGL02752:Il6st APN 13 112480195 missense probably damaging 0.98
IGL02988:Il6st UTSW 13 112498886 missense probably damaging 1.00
R0019:Il6st UTSW 13 112501148 missense possibly damaging 0.94
R0550:Il6st UTSW 13 112475114 splice site probably null
R1126:Il6st UTSW 13 112503732 missense probably damaging 1.00
R1452:Il6st UTSW 13 112481464 missense possibly damaging 0.79
R1581:Il6st UTSW 13 112481541 missense probably damaging 0.99
R1632:Il6st UTSW 13 112504332 missense possibly damaging 0.86
R1881:Il6st UTSW 13 112504413 missense probably damaging 1.00
R2013:Il6st UTSW 13 112498889 missense probably null 0.94
R2043:Il6st UTSW 13 112480219 missense probably benign 0.00
R2128:Il6st UTSW 13 112504175 missense probably benign 0.01
R2137:Il6st UTSW 13 112502858 missense possibly damaging 0.92
R3433:Il6st UTSW 13 112503831 missense probably damaging 1.00
R3696:Il6st UTSW 13 112504382 missense probably benign 0.13
R3697:Il6st UTSW 13 112504382 missense probably benign 0.13
R3698:Il6st UTSW 13 112504382 missense probably benign 0.13
R4172:Il6st UTSW 13 112495327 missense probably benign 0.25
R4543:Il6st UTSW 13 112481459 missense probably damaging 1.00
R4641:Il6st UTSW 13 112488530 missense probably damaging 1.00
R4838:Il6st UTSW 13 112490510 nonsense probably null
R4899:Il6st UTSW 13 112501161 missense probably damaging 1.00
R4922:Il6st UTSW 13 112502865 missense probably damaging 0.98
R5088:Il6st UTSW 13 112490555 missense probably damaging 1.00
R5104:Il6st UTSW 13 112488648 missense probably benign 0.02
R5853:Il6st UTSW 13 112481537 missense probably damaging 1.00
R6602:Il6st UTSW 13 112504413 missense probably damaging 1.00
R7082:Il6st UTSW 13 112504032 missense probably damaging 1.00
R7101:Il6st UTSW 13 112495373 critical splice donor site probably null
R7192:Il6st UTSW 13 112495207 missense probably benign 0.00
R7273:Il6st UTSW 13 112495298 missense probably benign 0.37
U24488:Il6st UTSW 13 112494634 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCCAGGCAACCGTATTTCAAGCAG -3'
(R):5'- TGCCTATCTTCAGGGAGTGAGGAC -3'

Sequencing Primer
(F):5'- AACCGTATTTCAAGCAGAACTG -3'
(R):5'- CTGAAGTTCAGGAGCCAGTC -3'
Posted On2013-07-11