Incidental Mutation 'R6960:Cc2d2b'
ID541732
Institutional Source Beutler Lab
Gene Symbol Cc2d2b
Ensembl Gene ENSMUSG00000108929
Gene Namecoiled-coil and C2 domain containing 2B
SynonymsEG668310
MMRRC Submission
Accession Numbers

NCBI RefSeq: XM_001000795; MGI: 3645359

Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6960 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40748753-40827743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40785062 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 523 (V523A)
Ref Sequence ENSEMBL: ENSMUSP00000153384 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000207801
Predicted Effect possibly damaging
Transcript: ENSMUST00000224596
AA Change: V523A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,072,924 D1170G probably benign Het
Ak7 A T 12: 105,710,244 T68S probably benign Het
Arhgap12 A T 18: 6,111,901 N26K probably damaging Het
B3galt1 A T 2: 68,118,689 E249D probably damaging Het
Catsper4 T A 4: 134,227,337 M1L probably benign Het
Cyp11a1 T C 9: 58,018,376 F98S probably damaging Het
Cyp2d26 T C 15: 82,790,245 S479G probably damaging Het
Dclre1a T G 19: 56,542,709 Y735S probably damaging Het
Dio2 C T 12: 90,729,897 G106R probably damaging Het
Efcab12 T C 6: 115,838,312 probably benign Het
Ehhadh C A 16: 21,762,278 V655L probably benign Het
Ercc2 G A 7: 19,393,690 R379Q probably damaging Het
Fabp4 A G 3: 10,208,477 V12A probably benign Het
Fbn1 T C 2: 125,382,060 I590V probably benign Het
Grm8 C A 6: 27,981,282 V210L probably damaging Het
Jakmip3 A G 7: 139,023,336 D359G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Ly75 A T 2: 60,306,405 Y1493N probably benign Het
Lyst A G 13: 13,634,078 N111S probably benign Het
Lyz2 G C 10: 117,278,702 I107M possibly damaging Het
Mgat5 A T 1: 127,320,634 D91V possibly damaging Het
Mical3 T A 6: 120,958,543 D1674V probably damaging Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Naa16 A G 14: 79,359,471 Y358H possibly damaging Het
Nktr T A 9: 121,742,692 H226Q probably damaging Het
Ocln T G 13: 100,498,872 K503T possibly damaging Het
Olfm4 T C 14: 80,021,314 L301S probably damaging Het
Olfr1289 G A 2: 111,483,726 V127I possibly damaging Het
Olfr821 T C 10: 130,034,103 L159P probably benign Het
Paqr4 G A 17: 23,737,723 A222V probably benign Het
Pcdhb13 A G 18: 37,443,456 T296A probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Pigg T C 5: 108,326,841 V309A probably damaging Het
Ptger4 T C 15: 5,234,715 R462G probably benign Het
Ptprc C T 1: 138,078,445 probably null Het
Rabggta A C 14: 55,721,842 probably null Het
Rnf25 A G 1: 74,595,244 S207P possibly damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Rtf1 A G 2: 119,711,078 Q264R probably damaging Het
Ryr2 A G 13: 11,801,243 V619A probably benign Het
Serpinb6d A G 13: 33,671,198 N285S probably benign Het
Slamf6 A G 1: 171,917,753 M16V probably damaging Het
Slc22a23 A G 13: 34,344,157 probably null Het
Slc23a2 T C 2: 132,091,253 D95G probably damaging Het
Smc3 T C 19: 53,629,371 Y600H probably damaging Het
Tarbp1 G A 8: 126,429,039 T1320M possibly damaging Het
Tigd4 A T 3: 84,594,116 K113N probably damaging Het
Tjp1 A T 7: 65,303,015 F1444I possibly damaging Het
Tstd3 A T 4: 21,767,118 M1K probably null Het
Wisp1 C T 15: 66,919,198 T283M probably benign Het
Zbtb46 T C 2: 181,423,424 D311G probably damaging Het
Other mutations in Cc2d2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
1mM(1):Cc2d2b UTSW 19 40795685 missense possibly damaging 0.60
R6163:Cc2d2b UTSW 19 40756506 missense probably benign 0.31
R6481:Cc2d2b UTSW 19 40802395 missense possibly damaging 0.95
R6651:Cc2d2b UTSW 19 40778129 missense probably damaging 0.97
R6747:Cc2d2b UTSW 19 40795667 missense probably benign 0.03
R6799:Cc2d2b UTSW 19 40791208 missense possibly damaging 0.69
R6857:Cc2d2b UTSW 19 40770865 missense possibly damaging 0.62
R6869:Cc2d2b UTSW 19 40809454 missense probably benign 0.06
R6881:Cc2d2b UTSW 19 40825039 missense probably damaging 0.99
R6900:Cc2d2b UTSW 19 40825074 missense probably null 0.08
R6902:Cc2d2b UTSW 19 40816289 missense possibly damaging 0.93
R7016:Cc2d2b UTSW 19 40795804 missense possibly damaging 0.85
R7039:Cc2d2b UTSW 19 40802401 missense probably damaging 1.00
R7072:Cc2d2b UTSW 19 40760359 missense unknown
R7192:Cc2d2b UTSW 19 40774437 missense unknown
R7226:Cc2d2b UTSW 19 40791307 missense unknown
R7303:Cc2d2b UTSW 19 40808994 missense unknown
R7324:Cc2d2b UTSW 19 40809108 missense unknown
Predicted Primers PCR Primer
(F):5'- CCACTCTTAGATAATTTGGGAGGG -3'
(R):5'- TCGCTAACCATAGAAGCCAG -3'

Sequencing Primer
(F):5'- GGGGAAGAGCGTTTTATATGGTC -3'
(R):5'- TCGCTAACCATAGAAGCCAGACATTC -3'
Posted On2018-11-28