Incidental Mutation 'R6961:9230113P08Rik'
List |< first << previous [record 32 of 1308] next >> last >|
ID541766
Institutional Source Beutler Lab
Gene Symbol 9230113P08Rik
Ensembl Gene ENSMUSG00000078934
Gene NameRIKEN cDNA 9230113P08 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.045) question?
Stock #R6961 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location35908423-35910796 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) G to A at 35908444 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000135716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176049] [ENSMUST00000176153]
Predicted Effect probably benign
Transcript: ENSMUST00000176049
Predicted Effect probably null
Transcript: ENSMUST00000176153
AA Change: M1I

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135716
Gene: ENSMUSG00000078934
AA Change: M1I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,876,301 L168P probably damaging Het
Atp6v0d1 A G 8: 105,529,217 L173P probably damaging Het
Baiap2l2 A G 15: 79,284,635 F23L probably damaging Het
Ccdc144b T A 3: 36,050,617 I32F possibly damaging Het
Cdh23 G C 10: 60,650,114 L41V probably benign Het
Cep120 C A 18: 53,703,205 E803* probably null Het
Clcn7 C T 17: 25,157,214 P560S probably damaging Het
Cldn12 A T 5: 5,507,707 V240D probably damaging Het
Clec1a C T 6: 129,429,983 E190K probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Crispld1 T A 1: 17,762,141 H450Q probably damaging Het
Dsc2 A T 18: 20,038,222 N573K probably damaging Het
Fam186a T A 15: 99,940,201 I2721F probably benign Het
Fbxl13 A G 5: 21,543,742 F393S probably damaging Het
Fut1 A T 7: 45,619,539 I306F probably damaging Het
Gas2l3 T C 10: 89,413,291 D655G probably benign Het
Gm15448 T C 7: 3,825,125 Y61C probably damaging Het
Gm29106 A T 1: 118,200,398 K607* probably null Het
Gm609 T A 16: 45,444,003 Y64F probably benign Het
Hmg20a T C 9: 56,488,728 V268A probably benign Het
Il2rb T A 15: 78,485,824 Y205F probably damaging Het
Ints4 A G 7: 97,541,190 *965W probably null Het
Itsn2 T A 12: 4,673,420 C1118* probably null Het
Jakmip1 T C 5: 37,173,353 L459P probably damaging Het
Klhl8 T C 5: 103,870,569 T323A possibly damaging Het
Mindy3 C A 2: 12,396,178 probably null Het
Myo3a A G 2: 22,245,558 T79A probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nudt21 A C 8: 94,028,880 D133E probably benign Het
Olfr1220 T A 2: 89,097,805 M41L probably benign Het
Olfr131 T A 17: 38,082,205 I258F probably damaging Het
Olfr601 A G 7: 103,358,582 V204A possibly damaging Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr690 A T 7: 105,329,706 I162K probably damaging Het
Olfr789 T C 10: 129,487,462 F151L probably damaging Het
Scfd2 A C 5: 74,519,541 V317G possibly damaging Het
Slc45a1 T C 4: 150,629,653 M712V probably damaging Het
Smg7 A T 1: 152,841,583 L919* probably null Het
Sspo T A 6: 48,463,877 S1758T probably benign Het
Tgfb2 A T 1: 186,649,835 M165K possibly damaging Het
Tie1 C T 4: 118,486,205 V154M probably damaging Het
Tlr5 C T 1: 182,973,511 R127* probably null Het
Ttc29 A C 8: 78,276,916 I254L possibly damaging Het
Unc79 T C 12: 103,112,915 S1780P probably damaging Het
Vmn2r106 A T 17: 20,268,384 Y584* probably null Het
Zbtb24 A G 10: 41,455,175 E366G probably damaging Het
Other mutations in 9230113P08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:9230113P08Rik APN 9 35908948 nonsense probably null
R1912:9230113P08Rik UTSW 9 35908619 missense probably benign 0.37
R4654:9230113P08Rik UTSW 9 35908991 missense probably damaging 0.98
R6465:9230113P08Rik UTSW 9 35908625 missense possibly damaging 0.92
R6547:9230113P08Rik UTSW 9 35908485 missense probably null 0.00
R6790:9230113P08Rik UTSW 9 35908831 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATTACAAGGTGTCTGTGTAGGC -3'
(R):5'- CAGTTAAATGTCAGCACTCTTTCTC -3'

Sequencing Primer
(F):5'- TCTGTGTAGGCTTAGTTCCAAG -3'
(R):5'- AGCACTCTTTCTCCTGTGAAGAG -3'
Posted On2018-11-28