Incidental Mutation 'R6961:Itsn2'
ID541772
Institutional Source Beutler Lab
Gene Symbol Itsn2
Ensembl Gene ENSMUSG00000020640
Gene Nameintersectin 2
SynonymsSh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6961 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location4592638-4713962 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 4673420 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1118 (C1118*)
Ref Sequence ENSEMBL: ENSMUSP00000151896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000219007] [ENSMUST00000220311]
Predicted Effect probably null
Transcript: ENSMUST00000062580
AA Change: C1091*
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: C1091*

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217672
AA Change: C649*
Predicted Effect probably null
Transcript: ENSMUST00000219007
AA Change: C1091*
Predicted Effect probably null
Transcript: ENSMUST00000220311
AA Change: C1118*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik G A 9: 35,908,444 M1I probably null Het
Aasdh A G 5: 76,876,301 L168P probably damaging Het
Atp6v0d1 A G 8: 105,529,217 L173P probably damaging Het
Baiap2l2 A G 15: 79,284,635 F23L probably damaging Het
Ccdc144b T A 3: 36,050,617 I32F possibly damaging Het
Cdh23 G C 10: 60,650,114 L41V probably benign Het
Cep120 C A 18: 53,703,205 E803* probably null Het
Clcn7 C T 17: 25,157,214 P560S probably damaging Het
Cldn12 A T 5: 5,507,707 V240D probably damaging Het
Clec1a C T 6: 129,429,983 E190K probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Crispld1 T A 1: 17,762,141 H450Q probably damaging Het
Dsc2 A T 18: 20,038,222 N573K probably damaging Het
Fam186a T A 15: 99,940,201 I2721F probably benign Het
Fbxl13 A G 5: 21,543,742 F393S probably damaging Het
Fut1 A T 7: 45,619,539 I306F probably damaging Het
Gas2l3 T C 10: 89,413,291 D655G probably benign Het
Gm15448 T C 7: 3,825,125 Y61C probably damaging Het
Gm29106 A T 1: 118,200,398 K607* probably null Het
Gm609 T A 16: 45,444,003 Y64F probably benign Het
Hmg20a T C 9: 56,488,728 V268A probably benign Het
Il2rb T A 15: 78,485,824 Y205F probably damaging Het
Ints4 A G 7: 97,541,190 *965W probably null Het
Jakmip1 T C 5: 37,173,353 L459P probably damaging Het
Klhl8 T C 5: 103,870,569 T323A possibly damaging Het
Mindy3 C A 2: 12,396,178 probably null Het
Myo3a A G 2: 22,245,558 T79A probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Napa C T 7: 16,109,109 R53* probably null Het
Nudt21 A C 8: 94,028,880 D133E probably benign Het
Olfr1220 T A 2: 89,097,805 M41L probably benign Het
Olfr131 T A 17: 38,082,205 I258F probably damaging Het
Olfr601 A G 7: 103,358,582 V204A possibly damaging Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr690 A T 7: 105,329,706 I162K probably damaging Het
Olfr789 T C 10: 129,487,462 F151L probably damaging Het
Pla2g4e G T 2: 120,174,370 probably null Het
Ptbp1 T C 10: 79,859,277 probably null Het
Scfd2 A C 5: 74,519,541 V317G possibly damaging Het
Slc45a1 T C 4: 150,629,653 M712V probably damaging Het
Smg7 A T 1: 152,841,583 L919* probably null Het
Sspo T A 6: 48,463,877 S1758T probably benign Het
Tgfb2 A T 1: 186,649,835 M165K possibly damaging Het
Tie1 C T 4: 118,486,205 V154M probably damaging Het
Timm17a A G 1: 135,311,078 probably benign Het
Tlr5 C T 1: 182,973,511 R127* probably null Het
Ttc29 A C 8: 78,276,916 I254L possibly damaging Het
Unc79 T C 12: 103,112,915 S1780P probably damaging Het
Vmn2r106 A T 17: 20,268,384 Y584* probably null Het
Zbtb24 A G 10: 41,455,175 E366G probably damaging Het
Other mutations in Itsn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Itsn2 APN 12 4658027 missense possibly damaging 0.95
IGL00647:Itsn2 APN 12 4613311 splice site probably benign
IGL00933:Itsn2 APN 12 4707540 missense probably damaging 1.00
IGL01686:Itsn2 APN 12 4636693 splice site probably benign
IGL01873:Itsn2 APN 12 4632366 splice site probably benign
IGL02200:Itsn2 APN 12 4636632 missense probably damaging 0.98
IGL02280:Itsn2 APN 12 4708961 missense possibly damaging 0.89
IGL02388:Itsn2 APN 12 4629557 missense possibly damaging 0.91
IGL02938:Itsn2 APN 12 4697216 missense probably damaging 0.98
inversus UTSW 12 4639670 nonsense probably null
liberator UTSW 12 4666176 nonsense probably null
rolled UTSW 12 4634792 nonsense probably null
stratofortress UTSW 12 4624927 missense probably damaging 1.00
R0101:Itsn2 UTSW 12 4633058 unclassified probably benign
R0268:Itsn2 UTSW 12 4700333 missense probably benign 0.12
R0584:Itsn2 UTSW 12 4697180 missense probably benign
R0604:Itsn2 UTSW 12 4658189 missense probably benign 0.01
R0639:Itsn2 UTSW 12 4712556 missense probably damaging 0.99
R0738:Itsn2 UTSW 12 4635681 missense probably benign 0.17
R1132:Itsn2 UTSW 12 4658464 missense probably damaging 1.00
R1163:Itsn2 UTSW 12 4712009 missense probably benign 0.30
R1169:Itsn2 UTSW 12 4639694 missense probably damaging 1.00
R1258:Itsn2 UTSW 12 4673464 missense probably damaging 1.00
R1297:Itsn2 UTSW 12 4700378 missense probably damaging 1.00
R1423:Itsn2 UTSW 12 4673572 missense probably damaging 0.97
R1572:Itsn2 UTSW 12 4650044 missense probably benign 0.03
R1601:Itsn2 UTSW 12 4658452 missense probably benign 0.01
R1628:Itsn2 UTSW 12 4629652 missense probably benign
R1650:Itsn2 UTSW 12 4637767 missense probably damaging 0.97
R1752:Itsn2 UTSW 12 4711950 splice site probably null
R1758:Itsn2 UTSW 12 4658160 missense possibly damaging 0.83
R1942:Itsn2 UTSW 12 4639670 nonsense probably null
R1976:Itsn2 UTSW 12 4672733 splice site probably benign
R2000:Itsn2 UTSW 12 4666176 nonsense probably null
R2060:Itsn2 UTSW 12 4627879 missense probably damaging 1.00
R2119:Itsn2 UTSW 12 4707025 missense probably benign 0.32
R2168:Itsn2 UTSW 12 4633044 unclassified probably benign
R2394:Itsn2 UTSW 12 4707005 missense possibly damaging 0.86
R2860:Itsn2 UTSW 12 4700315 splice site probably benign
R2861:Itsn2 UTSW 12 4700315 splice site probably benign
R2900:Itsn2 UTSW 12 4630713 unclassified probably benign
R2991:Itsn2 UTSW 12 4658474 missense probably benign 0.01
R3087:Itsn2 UTSW 12 4666303 missense probably damaging 1.00
R3881:Itsn2 UTSW 12 4634546 unclassified probably benign
R4022:Itsn2 UTSW 12 4624927 missense probably damaging 1.00
R4332:Itsn2 UTSW 12 4712611 missense possibly damaging 0.72
R4657:Itsn2 UTSW 12 4713197 makesense probably null
R4727:Itsn2 UTSW 12 4707660 missense probably damaging 0.99
R4745:Itsn2 UTSW 12 4661944 missense probably damaging 1.00
R4770:Itsn2 UTSW 12 4627892 missense probably damaging 1.00
R4905:Itsn2 UTSW 12 4634583 unclassified probably benign
R5269:Itsn2 UTSW 12 4633553 unclassified probably benign
R5314:Itsn2 UTSW 12 4627960 missense probably benign 0.09
R5345:Itsn2 UTSW 12 4672783 missense probably damaging 1.00
R5399:Itsn2 UTSW 12 4653535 missense probably benign 0.22
R5566:Itsn2 UTSW 12 4626554 missense probably damaging 1.00
R5725:Itsn2 UTSW 12 4630767 unclassified probably benign
R5773:Itsn2 UTSW 12 4707089 missense probably damaging 1.00
R6116:Itsn2 UTSW 12 4629939 unclassified probably benign
R6254:Itsn2 UTSW 12 4624982 splice site probably null
R6325:Itsn2 UTSW 12 4706351 missense probably damaging 1.00
R6361:Itsn2 UTSW 12 4629655 missense probably benign 0.18
R6456:Itsn2 UTSW 12 4629923 unclassified probably benign
R6494:Itsn2 UTSW 12 4634792 nonsense probably null
R6854:Itsn2 UTSW 12 4652382 missense probably benign 0.37
R6941:Itsn2 UTSW 12 4629641 missense probably benign 0.05
R7326:Itsn2 UTSW 12 4632985 missense unknown
R7387:Itsn2 UTSW 12 4639781 missense probably damaging 1.00
R7465:Itsn2 UTSW 12 4706983 nonsense probably null
R7471:Itsn2 UTSW 12 4708198 missense probably benign 0.43
Z1088:Itsn2 UTSW 12 4712472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAAATTGCTGCTTCATCAT -3'
(R):5'- TGGATCTGAGTCTGTTGTCATCT -3'

Sequencing Primer
(F):5'- CTGGAACTTACCTTGTAGACCAGG -3'
(R):5'- CTGAGTCTGTTGTCATCTTAACATAG -3'
Posted On2018-11-28