Incidental Mutation 'R0606:Hira'
ID54182
Institutional Source Beutler Lab
Gene Symbol Hira
Ensembl Gene ENSMUSG00000022702
Gene Namehistone cell cycle regulator
SynonymsD16Ertd95e, Gm15797, Tuple1
MMRRC Submission 038795-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0606 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18877037-18970309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18935047 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 547 (S547L)
Ref Sequence ENSEMBL: ENSMUSP00000004222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004222] [ENSMUST00000153397] [ENSMUST00000190050]
Predicted Effect probably benign
Transcript: ENSMUST00000004222
AA Change: S547L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004222
Gene: ENSMUSG00000022702
AA Change: S547L

DomainStartEndE-ValueType
WD40 1 44 1.56e-1 SMART
WD40 59 98 9.67e-7 SMART
WD40 120 159 3.58e-10 SMART
WD40 163 202 7.22e-6 SMART
WD40 212 254 9.17e1 SMART
WD40 257 313 1.54e0 SMART
WD40 319 356 2.86e0 SMART
low complexity region 405 412 N/A INTRINSIC
Pfam:HIRA_B 448 470 1.9e-10 PFAM
low complexity region 493 507 N/A INTRINSIC
low complexity region 540 556 N/A INTRINSIC
low complexity region 600 614 N/A INTRINSIC
low complexity region 626 641 N/A INTRINSIC
Pfam:Hira 761 960 2.9e-61 PFAM
low complexity region 979 989 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150799
Predicted Effect probably benign
Transcript: ENSMUST00000153397
SMART Domains Protein: ENSMUSP00000117944
Gene: ENSMUSG00000022702

DomainStartEndE-ValueType
Blast:WD40 1 40 1e-18 BLAST
SCOP:d1erja_ 7 33 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190050
SMART Domains Protein: ENSMUSP00000141101
Gene: ENSMUSG00000099908

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone chaperone that preferentially places the variant histone H3.3 in nucleosomes. Orthologs of this gene in yeast, flies, and plants are necessary for the formation of transcriptionally silent heterochomatin. This gene plays an important role in the formation of the senescence-associated heterochromatin foci. These foci likely mediate the irreversible cell cycle changes that occur in senescent cells. It is considered the primary candidate gene in some haploinsufficiency syndromes such as DiGeorge syndrome, and insufficient production of the gene may disrupt normal embryonic development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted gastrulation, malformations of axial and paraxial mesoendoderm, abnormal placentas, failure of cardiac development, and lethality by embryonic day 11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,259,089 Y128H probably damaging Het
Actl9 T C 17: 33,433,598 Y211H probably damaging Het
Actn1 A T 12: 80,174,647 probably benign Het
Adtrp A G 13: 41,767,405 F197L probably damaging Het
Ankrd11 G A 8: 122,892,832 T1406I probably benign Het
Arhgap24 A T 5: 102,897,220 R620W probably damaging Het
Atg13 A G 2: 91,682,073 Y284H probably benign Het
Atrn A G 2: 130,906,856 E99G possibly damaging Het
Cage1 A T 13: 38,016,494 probably benign Het
Ccr3 T A 9: 124,028,802 M58K probably benign Het
Cdk18 G T 1: 132,117,617 probably benign Het
Chst5 A G 8: 111,890,919 V23A probably benign Het
Col4a3 T C 1: 82,672,586 probably benign Het
Col4a6 A G X: 141,192,223 probably benign Het
Csmd3 T C 15: 48,457,662 I251V probably benign Het
Csnk1g3 G A 18: 53,917,028 V115M probably damaging Het
Cst7 A T 2: 150,570,519 M1L probably benign Het
Cyp4f17 A T 17: 32,527,843 D373V probably damaging Het
Dclk2 G A 3: 86,906,004 R212W probably damaging Het
Dhrs7b T G 11: 60,830,746 probably benign Het
Dhx58 T A 11: 100,702,251 H210L probably benign Het
Dnah9 T C 11: 65,841,333 Y4249C probably damaging Het
Eif5b T A 1: 38,048,893 L990H probably damaging Het
Faap24 T C 7: 35,394,963 probably benign Het
Fryl T A 5: 73,124,734 H174L probably benign Het
Gabrr1 T C 4: 33,132,696 W15R probably benign Het
Gif A T 19: 11,752,294 I206F possibly damaging Het
Gm15446 T C 5: 109,943,481 V533A probably benign Het
Gm6760 T A X: 64,151,653 K63* probably null Het
Gne C T 4: 44,042,244 E444K possibly damaging Het
Gpr173 T A X: 152,347,040 M146L possibly damaging Het
Hnf1b A G 11: 83,863,984 H161R probably benign Het
Hnrnpm T A 17: 33,658,390 N53I probably damaging Het
Hs3st5 A T 10: 36,832,588 I40F probably benign Het
Hydin C T 8: 110,549,798 probably benign Het
Ift172 A G 5: 31,254,313 I1607T probably damaging Het
Igfn1 T C 1: 135,959,901 Q2475R probably damaging Het
Il6st T C 13: 112,504,272 S800P possibly damaging Het
Iqub G A 6: 24,501,261 probably benign Het
Itgb1 A T 8: 128,722,372 probably benign Het
Kctd21 G A 7: 97,347,601 E94K probably benign Het
Kir3dl2 A G X: 136,453,511 V233A possibly damaging Het
Klra2 A T 6: 131,220,224 C271S probably damaging Het
Lacc1 A T 14: 77,029,621 C401S probably damaging Het
Lmna T C 3: 88,482,578 E580G probably damaging Het
Matn2 A G 15: 34,345,150 Y101C probably damaging Het
Mrps16 G A 14: 20,391,389 R116* probably null Het
Ndrg2 G T 14: 51,906,217 R333S probably damaging Het
Nf2 A G 11: 4,782,194 I507T possibly damaging Het
Nktr A G 9: 121,749,290 probably benign Het
Nkx3-1 G A 14: 69,191,006 probably benign Het
Npat T C 9: 53,556,481 probably null Het
Nrxn1 T C 17: 90,565,373 N1047S probably damaging Het
Nup210 A T 6: 91,026,929 I1402N possibly damaging Het
Olfr1168 G T 2: 88,185,280 M134I possibly damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdcl2 C T 5: 76,312,481 S182N probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pla2g4a A G 1: 149,840,704 F669L probably benign Het
Plekha8 A G 6: 54,629,820 K367E probably damaging Het
Pola1 A G X: 93,488,087 probably benign Het
Ppm1d C T 11: 85,345,877 T494I probably benign Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prl6a1 A T 13: 27,314,194 probably benign Het
Ptprg T A 14: 12,154,131 S617R probably benign Het
R3hdm2 G A 10: 127,444,444 G45D probably damaging Het
Rev1 T A 1: 38,059,123 R780W probably null Het
Rnf139 T A 15: 58,899,827 F567Y probably damaging Het
Scarf1 T C 11: 75,514,348 V71A probably damaging Het
Shtn1 A G 19: 58,999,940 S438P probably damaging Het
Slc30a3 T A 5: 31,088,723 H221L probably benign Het
Smo A C 6: 29,753,604 I160L possibly damaging Het
Snapc5 A T 9: 64,179,300 probably benign Het
Snf8 G T 11: 96,034,973 probably benign Het
Spata31d1a T C 13: 59,702,431 S628G probably benign Het
Sphkap A T 1: 83,280,424 D199E probably damaging Het
Stxbp5l T C 16: 37,204,521 T572A possibly damaging Het
Thada C A 17: 84,416,303 V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 Q735R probably benign Het
Tmem29 C T X: 150,398,364 A144T probably benign Het
Trim24 G A 6: 37,871,234 E42K probably benign Het
Trnt1 T A 6: 106,777,908 probably benign Het
Ttbk2 A T 2: 120,773,872 M215K probably damaging Het
Ttc8 C T 12: 98,943,459 probably benign Het
Ube3c A G 5: 29,590,928 Y105C probably damaging Het
Unc13c A G 9: 73,530,983 probably benign Het
Usp36 A G 11: 118,263,028 probably benign Het
Vmn2r102 T C 17: 19,678,844 S483P possibly damaging Het
Wdr95 A G 5: 149,588,130 T432A probably damaging Het
Wnk1 G T 6: 119,926,683 P2523H probably damaging Het
Xpo4 A G 14: 57,638,208 probably benign Het
Zar1 G T 5: 72,580,543 P71Q probably damaging Het
Zbtb41 T C 1: 139,423,610 Y154H probably benign Het
Zer1 G T 2: 30,104,797 probably benign Het
Zfp454 A G 11: 50,874,185 F140S probably benign Het
Other mutations in Hira
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Hira APN 16 18946340 splice site probably benign
IGL01285:Hira APN 16 18912180 missense probably benign 0.01
F5770:Hira UTSW 16 18894821 missense probably damaging 1.00
IGL02796:Hira UTSW 16 18925654 missense probably benign 0.01
R0123:Hira UTSW 16 18956171 missense probably benign 0.45
R0225:Hira UTSW 16 18956171 missense probably benign 0.45
R1017:Hira UTSW 16 18899347 intron probably null
R1456:Hira UTSW 16 18925663 missense probably benign 0.02
R1479:Hira UTSW 16 18896469 missense probably damaging 1.00
R1731:Hira UTSW 16 18933014 missense probably benign 0.01
R1830:Hira UTSW 16 18947414 missense probably damaging 1.00
R2039:Hira UTSW 16 18951701 missense probably benign 0.05
R4328:Hira UTSW 16 18896612 missense probably benign 0.01
R4401:Hira UTSW 16 18925720 missense probably damaging 1.00
R4423:Hira UTSW 16 18956202 missense possibly damaging 0.80
R4634:Hira UTSW 16 18946400 missense probably damaging 0.98
R4728:Hira UTSW 16 18922904 missense probably damaging 1.00
R5050:Hira UTSW 16 18925859 missense possibly damaging 0.75
R5139:Hira UTSW 16 18954758 missense probably damaging 1.00
R5201:Hira UTSW 16 18952115 missense probably damaging 0.98
R5327:Hira UTSW 16 18954758 missense probably damaging 1.00
R5483:Hira UTSW 16 18969540 missense possibly damaging 0.89
R5573:Hira UTSW 16 18916599 missense probably damaging 1.00
R5626:Hira UTSW 16 18927512 missense probably damaging 0.97
R5768:Hira UTSW 16 18935018 splice site probably benign
R5952:Hira UTSW 16 18935065 missense possibly damaging 0.83
R6128:Hira UTSW 16 18932977 missense probably benign 0.08
R6280:Hira UTSW 16 18910707 missense probably damaging 1.00
R7116:Hira UTSW 16 18912114 missense probably damaging 1.00
V7581:Hira UTSW 16 18894821 missense probably damaging 1.00
V7582:Hira UTSW 16 18894821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATAGTTCACCGTGGAAGTGGCAG -3'
(R):5'- TGAAGTCCCGAGGAGATACAGTAGC -3'

Sequencing Primer
(F):5'- caaacaaacaaacaaacaaaaaacaC -3'
(R):5'- TAGCTACCACCTACCTTTCAACAG -3'
Posted On2013-07-11