Incidental Mutation 'R6962:Smpd3'
ID541827
Institutional Source Beutler Lab
Gene Symbol Smpd3
Ensembl Gene ENSMUSG00000031906
Gene Namesphingomyelin phosphodiesterase 3, neutral
Synonymsneutral sphingomyelinase II, nSMase2, fro, 4631433G07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R6962 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location106252548-106337988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106265219 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 234 (D234G)
Ref Sequence ENSEMBL: ENSMUSP00000148282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067512] [ENSMUST00000212896]
Predicted Effect probably benign
Transcript: ENSMUST00000067512
AA Change: D234G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000069255
Gene: ENSMUSG00000031906
AA Change: D234G

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
Pfam:Exo_endo_phos 321 639 1.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212896
AA Change: D234G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 96% (74/77)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit dwarfism, delayed sexual and gonad maturation, delayed ossification of the long bones, and reduced serum levels of thyroxine, triiodothyronine, cortisol, and insulin-like growth factor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,064,949 K1016E probably benign Het
9130019O22Rik A T 7: 127,384,315 D538E possibly damaging Het
Abca3 T C 17: 24,364,726 F30L probably benign Het
Arhgap17 C T 7: 123,296,432 G490R probably damaging Het
Arsg T A 11: 109,521,669 L140H probably damaging Het
Bmp2k T A 5: 97,031,238 C130* probably null Het
C4b T C 17: 34,732,166 probably null Het
Cdk5r2 A G 1: 74,855,816 Y240C probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Col27a1 A G 4: 63,319,501 probably benign Het
Cubn G A 2: 13,348,029 S1966F probably benign Het
Dnajc13 T C 9: 104,181,009 Y1509C probably benign Het
Dpp4 A G 2: 62,372,830 V265A probably benign Het
Fbxl8 C A 8: 105,268,706 N283K possibly damaging Het
Fev T A 1: 74,882,140 Q122L probably benign Het
Fgd4 T A 16: 16,484,087 probably null Het
Fnip2 A C 3: 79,489,303 L439R probably damaging Het
Git1 C A 11: 77,504,643 Q389K probably benign Het
Gm10509 C G 17: 21,690,926 I53M possibly damaging Het
Gm12394 T C 4: 42,793,323 T270A probably damaging Het
Gm5773 A T 3: 93,773,927 H302L possibly damaging Het
Gm884 G A 11: 103,614,300 P105S possibly damaging Het
Greb1l G T 18: 10,547,327 R1515L probably damaging Het
Gsc2 T C 16: 17,915,038 Y2C possibly damaging Het
H60b A G 10: 22,286,154 N93D probably benign Het
Hgf G A 5: 16,615,754 R633Q probably benign Het
Hmgb1 C T 5: 149,048,823 probably benign Het
Hmmr T C 11: 40,707,415 T657A probably damaging Het
Htt G T 5: 34,899,771 probably null Het
Ift80 G A 3: 68,994,545 probably benign Het
Kcnq5 G T 1: 21,505,793 T229K probably damaging Het
Kcp C T 6: 29,482,840 R1410Q probably benign Het
Klhl30 T G 1: 91,357,415 V331G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Macf1 C T 4: 123,440,722 R2849Q probably benign Het
Mex3b T G 7: 82,869,265 S263A probably benign Het
Mrgpre A G 7: 143,781,062 S235P probably damaging Het
Myh14 A T 7: 44,657,939 V226D probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nudt8 G T 19: 4,001,831 L147F probably damaging Het
Olfr1141 A G 2: 87,753,727 Y89H probably benign Het
Olfr170 T A 16: 19,605,922 I249L probably benign Het
Olfr5 A T 7: 6,481,009 I49N probably benign Het
Olfr671 T A 7: 104,975,373 N208I probably benign Het
P4htm C A 9: 108,579,195 A469S possibly damaging Het
Pld4 A T 12: 112,766,854 H288L probably benign Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppcs T G 4: 119,422,178 N59T probably damaging Het
Ppm1k A T 6: 57,515,660 C214S probably damaging Het
Psg25 C T 7: 18,529,754 G48E probably damaging Het
Rassf7 A G 7: 141,217,590 T239A possibly damaging Het
Rgs3 G T 4: 62,700,715 probably benign Het
Scaper T C 9: 55,859,771 T465A probably benign Het
Slc4a7 G T 14: 14,746,021 G405C probably damaging Het
Ssc4d A G 5: 135,962,921 probably null Het
Sugct G T 13: 16,858,021 probably null Het
Taok2 C A 7: 126,866,916 probably null Het
Tbx20 A G 9: 24,769,740 V152A probably damaging Het
Tbx4 A G 11: 85,890,259 E66G probably benign Het
Thbs2 T C 17: 14,681,820 E382G probably benign Het
Ticrr T G 7: 79,665,897 S300A possibly damaging Het
Trim46 A G 3: 89,238,996 L396P probably damaging Het
Trim56 A G 5: 137,112,647 F672L probably damaging Het
Ttf2 A G 3: 100,951,137 L712S probably damaging Het
Unc93b1 T G 19: 3,936,303 D112E possibly damaging Het
Usp17lc T C 7: 103,418,911 L471P probably benign Het
Vmn2r85 A G 10: 130,425,583 I295T probably damaging Het
Vmn2r96 T G 17: 18,598,021 I812S probably damaging Het
Wdr60 A T 12: 116,211,778 D926E probably damaging Het
Wdr7 G A 18: 63,865,288 C1102Y possibly damaging Het
Wnt9b G T 11: 103,733,689 Q92K probably null Het
Zbtb26 A T 2: 37,436,094 M310K possibly damaging Het
Zdhhc1 T C 8: 105,483,647 H46R probably damaging Het
Zfp628 G T 7: 4,919,550 R257L probably benign Het
Zmat4 A G 8: 23,902,165 T46A probably benign Het
Zmiz2 T A 11: 6,402,455 W637R probably damaging Het
Other mutations in Smpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03380:Smpd3 APN 8 106259659 missense probably benign 0.01
R0240:Smpd3 UTSW 8 106265156 missense probably damaging 0.96
R0240:Smpd3 UTSW 8 106265156 missense probably damaging 0.96
R0456:Smpd3 UTSW 8 106259656 missense probably benign
R0759:Smpd3 UTSW 8 106265228 missense probably benign 0.34
R0799:Smpd3 UTSW 8 106264789 missense possibly damaging 0.92
R1544:Smpd3 UTSW 8 106265567 missense possibly damaging 0.70
R1756:Smpd3 UTSW 8 106264971 missense probably benign
R2937:Smpd3 UTSW 8 106264820 missense probably damaging 1.00
R2939:Smpd3 UTSW 8 106257407 missense probably benign 0.00
R4614:Smpd3 UTSW 8 106259739 missense probably damaging 1.00
R5829:Smpd3 UTSW 8 106264880 missense probably benign 0.15
R6822:Smpd3 UTSW 8 106265964 start gained probably benign
R6891:Smpd3 UTSW 8 106264668 missense probably damaging 1.00
R6965:Smpd3 UTSW 8 106259881 missense probably damaging 1.00
R7344:Smpd3 UTSW 8 106265193 missense probably damaging 1.00
R7394:Smpd3 UTSW 8 106265010 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGGTCTTATACAGCAGCTTGC -3'
(R):5'- ATCAGTGCAGCCAGCTTCAG -3'

Sequencing Primer
(F):5'- TTCACCAAGGACTCCCTGGAG -3'
(R):5'- TTCAGCAGCCTGGTGTCG -3'
Posted On2018-11-28