Incidental Mutation 'R6962:Git1'
ID541836
Institutional Source Beutler Lab
Gene Symbol Git1
Ensembl Gene ENSMUSG00000011877
Gene NameG protein-coupled receptor kinase-interactor 1
Synonymsp95Cat, Cat-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6962 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location77493562-77507786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 77504643 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 389 (Q389K)
Ref Sequence ENSEMBL: ENSMUSP00000037210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037285] [ENSMUST00000060417] [ENSMUST00000100812]
Predicted Effect probably benign
Transcript: ENSMUST00000037285
AA Change: Q389K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037210
Gene: ENSMUSG00000011877
AA Change: Q389K

DomainStartEndE-ValueType
ArfGap 1 124 1.82e-45 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 2.47e0 SMART
ANK 199 228 4.6e0 SMART
GIT 273 303 1.01e-10 SMART
GIT 337 367 1.99e-9 SMART
Pfam:GIT_CC 418 483 8.6e-34 PFAM
Pfam:GIT1_C 647 763 3.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060417
SMART Domains Protein: ENSMUSP00000057592
Gene: ENSMUSG00000044328

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
low complexity region 130 139 N/A INTRINSIC
low complexity region 188 205 N/A INTRINSIC
low complexity region 222 236 N/A INTRINSIC
low complexity region 281 299 N/A INTRINSIC
transmembrane domain 303 325 N/A INTRINSIC
low complexity region 350 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100812
AA Change: Q380K

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098375
Gene: ENSMUSG00000011877
AA Change: Q380K

DomainStartEndE-ValueType
ArfGap 1 124 1.82e-45 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 2.47e0 SMART
ANK 199 228 4.6e0 SMART
GIT 264 294 1.01e-10 SMART
GIT 328 358 1.99e-9 SMART
PDB:2W6A|B 417 473 3e-28 PDB
low complexity region 474 484 N/A INTRINSIC
Pfam:GIT1_C 632 756 4.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136101
SMART Domains Protein: ENSMUSP00000122898
Gene: ENSMUSG00000044328

DomainStartEndE-ValueType
low complexity region 114 127 N/A INTRINSIC
low complexity region 167 176 N/A INTRINSIC
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 96% (74/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality associated with abnormal lung vascular development with surviving mice exhibiting abnormal learning and anxiety related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,064,949 K1016E probably benign Het
9130019O22Rik A T 7: 127,384,315 D538E possibly damaging Het
Abca3 T C 17: 24,364,726 F30L probably benign Het
Arhgap17 C T 7: 123,296,432 G490R probably damaging Het
Arsg T A 11: 109,521,669 L140H probably damaging Het
Bmp2k T A 5: 97,031,238 C130* probably null Het
C4b T C 17: 34,732,166 probably null Het
Cdk5r2 A G 1: 74,855,816 Y240C probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Col27a1 A G 4: 63,319,501 probably benign Het
Cubn G A 2: 13,348,029 S1966F probably benign Het
Dnajc13 T C 9: 104,181,009 Y1509C probably benign Het
Dpp4 A G 2: 62,372,830 V265A probably benign Het
Fbxl8 C A 8: 105,268,706 N283K possibly damaging Het
Fev T A 1: 74,882,140 Q122L probably benign Het
Fgd4 T A 16: 16,484,087 probably null Het
Fnip2 A C 3: 79,489,303 L439R probably damaging Het
Gm10509 C G 17: 21,690,926 I53M possibly damaging Het
Gm12394 T C 4: 42,793,323 T270A probably damaging Het
Gm5773 A T 3: 93,773,927 H302L possibly damaging Het
Gm884 G A 11: 103,614,300 P105S possibly damaging Het
Greb1l G T 18: 10,547,327 R1515L probably damaging Het
Gsc2 T C 16: 17,915,038 Y2C possibly damaging Het
H60b A G 10: 22,286,154 N93D probably benign Het
Hgf G A 5: 16,615,754 R633Q probably benign Het
Hmgb1 C T 5: 149,048,823 probably benign Het
Hmmr T C 11: 40,707,415 T657A probably damaging Het
Htt G T 5: 34,899,771 probably null Het
Ift80 G A 3: 68,994,545 probably benign Het
Kcnq5 G T 1: 21,505,793 T229K probably damaging Het
Kcp C T 6: 29,482,840 R1410Q probably benign Het
Klhl30 T G 1: 91,357,415 V331G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Macf1 C T 4: 123,440,722 R2849Q probably benign Het
Mex3b T G 7: 82,869,265 S263A probably benign Het
Mrgpre A G 7: 143,781,062 S235P probably damaging Het
Myh14 A T 7: 44,657,939 V226D probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nudt8 G T 19: 4,001,831 L147F probably damaging Het
Olfr1141 A G 2: 87,753,727 Y89H probably benign Het
Olfr170 T A 16: 19,605,922 I249L probably benign Het
Olfr5 A T 7: 6,481,009 I49N probably benign Het
Olfr671 T A 7: 104,975,373 N208I probably benign Het
P4htm C A 9: 108,579,195 A469S possibly damaging Het
Pld4 A T 12: 112,766,854 H288L probably benign Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppcs T G 4: 119,422,178 N59T probably damaging Het
Ppm1k A T 6: 57,515,660 C214S probably damaging Het
Psg25 C T 7: 18,529,754 G48E probably damaging Het
Rassf7 A G 7: 141,217,590 T239A possibly damaging Het
Rgs3 G T 4: 62,700,715 probably benign Het
Scaper T C 9: 55,859,771 T465A probably benign Het
Slc4a7 G T 14: 14,746,021 G405C probably damaging Het
Smpd3 T C 8: 106,265,219 D234G probably benign Het
Ssc4d A G 5: 135,962,921 probably null Het
Sugct G T 13: 16,858,021 probably null Het
Taok2 C A 7: 126,866,916 probably null Het
Tbx20 A G 9: 24,769,740 V152A probably damaging Het
Tbx4 A G 11: 85,890,259 E66G probably benign Het
Thbs2 T C 17: 14,681,820 E382G probably benign Het
Ticrr T G 7: 79,665,897 S300A possibly damaging Het
Trim46 A G 3: 89,238,996 L396P probably damaging Het
Trim56 A G 5: 137,112,647 F672L probably damaging Het
Ttf2 A G 3: 100,951,137 L712S probably damaging Het
Unc93b1 T G 19: 3,936,303 D112E possibly damaging Het
Usp17lc T C 7: 103,418,911 L471P probably benign Het
Vmn2r85 A G 10: 130,425,583 I295T probably damaging Het
Vmn2r96 T G 17: 18,598,021 I812S probably damaging Het
Wdr60 A T 12: 116,211,778 D926E probably damaging Het
Wdr7 G A 18: 63,865,288 C1102Y possibly damaging Het
Wnt9b G T 11: 103,733,689 Q92K probably null Het
Zbtb26 A T 2: 37,436,094 M310K possibly damaging Het
Zdhhc1 T C 8: 105,483,647 H46R probably damaging Het
Zfp628 G T 7: 4,919,550 R257L probably benign Het
Zmat4 A G 8: 23,902,165 T46A probably benign Het
Zmiz2 T A 11: 6,402,455 W637R probably damaging Het
Other mutations in Git1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Git1 APN 11 77505957 missense probably benign
IGL00401:Git1 APN 11 77498956 splice site probably benign
IGL02143:Git1 APN 11 77505987 missense possibly damaging 0.94
IGL02451:Git1 APN 11 77500687 missense possibly damaging 0.66
IGL02474:Git1 APN 11 77503391 missense probably damaging 1.00
IGL02517:Git1 APN 11 77499587 missense probably benign 0.03
IGL02933:Git1 APN 11 77501076 missense probably damaging 0.98
R0148:Git1 UTSW 11 77505728 missense probably benign 0.28
R0195:Git1 UTSW 11 77501073 missense probably benign 0.07
R0762:Git1 UTSW 11 77499834 missense possibly damaging 0.80
R1439:Git1 UTSW 11 77506418 missense possibly damaging 0.89
R1739:Git1 UTSW 11 77498982 missense probably damaging 1.00
R4471:Git1 UTSW 11 77499824 missense probably benign 0.26
R4482:Git1 UTSW 11 77500507 missense possibly damaging 0.89
R4653:Git1 UTSW 11 77505043 missense possibly damaging 0.94
R4783:Git1 UTSW 11 77499837 missense probably damaging 1.00
R5014:Git1 UTSW 11 77498995 missense probably damaging 1.00
R5703:Git1 UTSW 11 77504668 frame shift probably null
R5984:Git1 UTSW 11 77506483 missense possibly damaging 0.76
R6972:Git1 UTSW 11 77499521 missense probably damaging 1.00
R7012:Git1 UTSW 11 77499780 missense probably damaging 1.00
X0028:Git1 UTSW 11 77499046 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGACATTCTCAGTGAGGCC -3'
(R):5'- CAAAGCTGGGCTATGTATAACATGG -3'

Sequencing Primer
(F):5'- TTCTCAGTGAGGCCAAACG -3'
(R):5'- GCTATGTATAACATGGAACTGGGTC -3'
Posted On2018-11-28