Incidental Mutation 'R0606:Stxbp5l'
ID54184
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Namesyntaxin binding protein 5-like
Synonymst2md1, insulin level locus 1, tomosyn-2, T2dm1, A830015P08Rik, LLGL4
MMRRC Submission 038795-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0606 (G1)
Quality Score135
Status Validated
Chromosome16
Chromosomal Location37114942-37384962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37204521 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 572 (T572A)
Ref Sequence ENSEMBL: ENSMUSP00000110435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023526] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023526
SMART Domains Protein: ENSMUSP00000023526
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 2e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 7.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
low complexity region 790 804 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114780
AA Change: T572A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829
AA Change: T572A

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000114781
AA Change: T572A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829
AA Change: T572A

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000114782
AA Change: T572A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829
AA Change: T572A

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000114787
AA Change: T572A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829
AA Change: T572A

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149984
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,259,089 Y128H probably damaging Het
Actl9 T C 17: 33,433,598 Y211H probably damaging Het
Actn1 A T 12: 80,174,647 probably benign Het
Adtrp A G 13: 41,767,405 F197L probably damaging Het
Ankrd11 G A 8: 122,892,832 T1406I probably benign Het
Arhgap24 A T 5: 102,897,220 R620W probably damaging Het
Atg13 A G 2: 91,682,073 Y284H probably benign Het
Atrn A G 2: 130,906,856 E99G possibly damaging Het
Cage1 A T 13: 38,016,494 probably benign Het
Ccr3 T A 9: 124,028,802 M58K probably benign Het
Cdk18 G T 1: 132,117,617 probably benign Het
Chst5 A G 8: 111,890,919 V23A probably benign Het
Col4a3 T C 1: 82,672,586 probably benign Het
Col4a6 A G X: 141,192,223 probably benign Het
Csmd3 T C 15: 48,457,662 I251V probably benign Het
Csnk1g3 G A 18: 53,917,028 V115M probably damaging Het
Cst7 A T 2: 150,570,519 M1L probably benign Het
Cyp4f17 A T 17: 32,527,843 D373V probably damaging Het
Dclk2 G A 3: 86,906,004 R212W probably damaging Het
Dhrs7b T G 11: 60,830,746 probably benign Het
Dhx58 T A 11: 100,702,251 H210L probably benign Het
Dnah9 T C 11: 65,841,333 Y4249C probably damaging Het
Eif5b T A 1: 38,048,893 L990H probably damaging Het
Faap24 T C 7: 35,394,963 probably benign Het
Fryl T A 5: 73,124,734 H174L probably benign Het
Gabrr1 T C 4: 33,132,696 W15R probably benign Het
Gif A T 19: 11,752,294 I206F possibly damaging Het
Gm15446 T C 5: 109,943,481 V533A probably benign Het
Gm6760 T A X: 64,151,653 K63* probably null Het
Gne C T 4: 44,042,244 E444K possibly damaging Het
Gpr173 T A X: 152,347,040 M146L possibly damaging Het
Hira C T 16: 18,935,047 S547L probably benign Het
Hnf1b A G 11: 83,863,984 H161R probably benign Het
Hnrnpm T A 17: 33,658,390 N53I probably damaging Het
Hs3st5 A T 10: 36,832,588 I40F probably benign Het
Hydin C T 8: 110,549,798 probably benign Het
Ift172 A G 5: 31,254,313 I1607T probably damaging Het
Igfn1 T C 1: 135,959,901 Q2475R probably damaging Het
Il6st T C 13: 112,504,272 S800P possibly damaging Het
Iqub G A 6: 24,501,261 probably benign Het
Itgb1 A T 8: 128,722,372 probably benign Het
Kctd21 G A 7: 97,347,601 E94K probably benign Het
Kir3dl2 A G X: 136,453,511 V233A possibly damaging Het
Klra2 A T 6: 131,220,224 C271S probably damaging Het
Lacc1 A T 14: 77,029,621 C401S probably damaging Het
Lmna T C 3: 88,482,578 E580G probably damaging Het
Matn2 A G 15: 34,345,150 Y101C probably damaging Het
Mrps16 G A 14: 20,391,389 R116* probably null Het
Ndrg2 G T 14: 51,906,217 R333S probably damaging Het
Nf2 A G 11: 4,782,194 I507T possibly damaging Het
Nktr A G 9: 121,749,290 probably benign Het
Nkx3-1 G A 14: 69,191,006 probably benign Het
Npat T C 9: 53,556,481 probably null Het
Nrxn1 T C 17: 90,565,373 N1047S probably damaging Het
Nup210 A T 6: 91,026,929 I1402N possibly damaging Het
Olfr1168 G T 2: 88,185,280 M134I possibly damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdcl2 C T 5: 76,312,481 S182N probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pla2g4a A G 1: 149,840,704 F669L probably benign Het
Plekha8 A G 6: 54,629,820 K367E probably damaging Het
Pola1 A G X: 93,488,087 probably benign Het
Ppm1d C T 11: 85,345,877 T494I probably benign Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prl6a1 A T 13: 27,314,194 probably benign Het
Ptprg T A 14: 12,154,131 S617R probably benign Het
R3hdm2 G A 10: 127,444,444 G45D probably damaging Het
Rev1 T A 1: 38,059,123 R780W probably null Het
Rnf139 T A 15: 58,899,827 F567Y probably damaging Het
Scarf1 T C 11: 75,514,348 V71A probably damaging Het
Shtn1 A G 19: 58,999,940 S438P probably damaging Het
Slc30a3 T A 5: 31,088,723 H221L probably benign Het
Smo A C 6: 29,753,604 I160L possibly damaging Het
Snapc5 A T 9: 64,179,300 probably benign Het
Snf8 G T 11: 96,034,973 probably benign Het
Spata31d1a T C 13: 59,702,431 S628G probably benign Het
Sphkap A T 1: 83,280,424 D199E probably damaging Het
Thada C A 17: 84,416,303 V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 Q735R probably benign Het
Tmem29 C T X: 150,398,364 A144T probably benign Het
Trim24 G A 6: 37,871,234 E42K probably benign Het
Trnt1 T A 6: 106,777,908 probably benign Het
Ttbk2 A T 2: 120,773,872 M215K probably damaging Het
Ttc8 C T 12: 98,943,459 probably benign Het
Ube3c A G 5: 29,590,928 Y105C probably damaging Het
Unc13c A G 9: 73,530,983 probably benign Het
Usp36 A G 11: 118,263,028 probably benign Het
Vmn2r102 T C 17: 19,678,844 S483P possibly damaging Het
Wdr95 A G 5: 149,588,130 T432A probably damaging Het
Wnk1 G T 6: 119,926,683 P2523H probably damaging Het
Xpo4 A G 14: 57,638,208 probably benign Het
Zar1 G T 5: 72,580,543 P71Q probably damaging Het
Zbtb41 T C 1: 139,423,610 Y154H probably benign Het
Zer1 G T 2: 30,104,797 probably benign Het
Zfp454 A G 11: 50,874,185 F140S probably benign Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37208100 missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37204578 missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37215979 missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37345092 missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37200592 missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37329895 missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37208205 missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37186654 nonsense probably null
IGL03125:Stxbp5l APN 16 37186721 missense probably benign 0.02
R0058:Stxbp5l UTSW 16 37142374 missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37288308 missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37216078 splice site probably benign
R0454:Stxbp5l UTSW 16 37134284 missense possibly damaging 0.94
R0525:Stxbp5l UTSW 16 37129797 critical splice donor site probably null
R0543:Stxbp5l UTSW 16 37208096 missense probably damaging 1.00
R0607:Stxbp5l UTSW 16 37142432 missense probably benign 0.00
R1333:Stxbp5l UTSW 16 37247869 critical splice donor site probably null
R1593:Stxbp5l UTSW 16 37116052 missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37208111 missense probably benign 0.34
R1670:Stxbp5l UTSW 16 37290927 critical splice donor site probably null
R2077:Stxbp5l UTSW 16 37236275 missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37216036 missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 37115667 missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37208186 missense possibly damaging 0.89
R2917:Stxbp5l UTSW 16 37200642 nonsense probably null
R2918:Stxbp5l UTSW 16 37200642 nonsense probably null
R2935:Stxbp5l UTSW 16 37134189 missense possibly damaging 0.76
R3693:Stxbp5l UTSW 16 37241346 nonsense probably null
R3694:Stxbp5l UTSW 16 37241346 nonsense probably null
R3695:Stxbp5l UTSW 16 37241346 nonsense probably null
R4133:Stxbp5l UTSW 16 37208119 missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37247880 missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37255884 missense probably damaging 1.00
R4757:Stxbp5l UTSW 16 37188634 missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 37134230 missense probably benign 0.18
R5105:Stxbp5l UTSW 16 37142372 missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37186654 missense probably benign 0.19
R5358:Stxbp5l UTSW 16 37174326 missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 37129851 missense probably damaging 1.00
R5773:Stxbp5l UTSW 16 37208097 missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 37129815 missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37204448 missense possibly damaging 0.74
R6892:Stxbp5l UTSW 16 37188629 missense possibly damaging 0.94
Z1088:Stxbp5l UTSW 16 37204489 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGGAGGTTATTCAAAGACAATCATGCT -3'
(R):5'- TTTCTGCCACACAAATGCAATATGAAGG -3'

Sequencing Primer
(F):5'- GAGAGAGCAATAACTTTAACCGTTAC -3'
(R):5'- gtgagcaggacacccag -3'
Posted On2013-07-11