Incidental Mutation 'R0606:Stxbp5l'
ID 54184
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Name syntaxin binding protein 5-like
Synonyms insulin level locus 1, T2dm1, LLGL4, tomosyn-2, t2md1, A830015P08Rik
MMRRC Submission 038795-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0606 (G1)
Quality Score 135
Status Validated
Chromosome 16
Chromosomal Location 36935304-37205324 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37024883 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 572 (T572A)
Ref Sequence ENSEMBL: ENSMUSP00000110435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023526] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
AlphaFold Q5DQR4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023526
SMART Domains Protein: ENSMUSP00000023526
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 2e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 7.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
low complexity region 790 804 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114780
AA Change: T572A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829
AA Change: T572A

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000114781
AA Change: T572A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829
AA Change: T572A

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000114782
AA Change: T572A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829
AA Change: T572A

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000114787
AA Change: T572A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829
AA Change: T572A

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149984
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 T C 17: 33,652,572 (GRCm39) Y211H probably damaging Het
Actn1 A T 12: 80,221,421 (GRCm39) probably benign Het
Adtrp A G 13: 41,920,881 (GRCm39) F197L probably damaging Het
Ankrd11 G A 8: 123,619,571 (GRCm39) T1406I probably benign Het
Arhgap24 A T 5: 103,045,086 (GRCm39) R620W probably damaging Het
Atg13 A G 2: 91,512,418 (GRCm39) Y284H probably benign Het
Atrn A G 2: 130,748,776 (GRCm39) E99G possibly damaging Het
Cage1 A T 13: 38,200,470 (GRCm39) probably benign Het
Cblif A T 19: 11,729,658 (GRCm39) I206F possibly damaging Het
Ccr3 T A 9: 123,828,839 (GRCm39) M58K probably benign Het
Cdk18 G T 1: 132,045,355 (GRCm39) probably benign Het
Chst5 A G 8: 112,617,551 (GRCm39) V23A probably benign Het
Col4a3 T C 1: 82,650,307 (GRCm39) probably benign Het
Col4a6 A G X: 139,975,219 (GRCm39) probably benign Het
Csmd3 T C 15: 48,321,058 (GRCm39) I251V probably benign Het
Csnk1g3 G A 18: 54,050,100 (GRCm39) V115M probably damaging Het
Cst7 A T 2: 150,412,439 (GRCm39) M1L probably benign Het
Cyp4f17 A T 17: 32,746,817 (GRCm39) D373V probably damaging Het
Dclk2 G A 3: 86,813,311 (GRCm39) R212W probably damaging Het
Dhrs7b T G 11: 60,721,572 (GRCm39) probably benign Het
Dhx58 T A 11: 100,593,077 (GRCm39) H210L probably benign Het
Dnah9 T C 11: 65,732,159 (GRCm39) Y4249C probably damaging Het
Eif5b T A 1: 38,087,974 (GRCm39) L990H probably damaging Het
Faap24 T C 7: 35,094,388 (GRCm39) probably benign Het
Fryl T A 5: 73,282,077 (GRCm39) H174L probably benign Het
Gabrr1 T C 4: 33,132,696 (GRCm39) W15R probably benign Het
Gm15446 T C 5: 110,091,347 (GRCm39) V533A probably benign Het
Gm6760 T A X: 63,195,259 (GRCm39) K63* probably null Het
Gne C T 4: 44,042,244 (GRCm39) E444K possibly damaging Het
Gpr173 T A X: 151,130,036 (GRCm39) M146L possibly damaging Het
Hira C T 16: 18,753,797 (GRCm39) S547L probably benign Het
Hnf1b A G 11: 83,754,810 (GRCm39) H161R probably benign Het
Hnrnpm T A 17: 33,877,364 (GRCm39) N53I probably damaging Het
Hs3st5 A T 10: 36,708,584 (GRCm39) I40F probably benign Het
Hydin C T 8: 111,276,430 (GRCm39) probably benign Het
Ift172 A G 5: 31,411,657 (GRCm39) I1607T probably damaging Het
Igfn1 T C 1: 135,887,639 (GRCm39) Q2475R probably damaging Het
Il6st T C 13: 112,640,806 (GRCm39) S800P possibly damaging Het
Iqub G A 6: 24,501,260 (GRCm39) probably benign Het
Itgb1 A T 8: 129,448,853 (GRCm39) probably benign Het
Kctd21 G A 7: 96,996,808 (GRCm39) E94K probably benign Het
Kir3dl2 A G X: 135,354,260 (GRCm39) V233A possibly damaging Het
Klra2 A T 6: 131,197,187 (GRCm39) C271S probably damaging Het
Lacc1 A T 14: 77,267,061 (GRCm39) C401S probably damaging Het
Lmna T C 3: 88,389,885 (GRCm39) E580G probably damaging Het
Matn2 A G 15: 34,345,296 (GRCm39) Y101C probably damaging Het
Mrps16 G A 14: 20,441,457 (GRCm39) R116* probably null Het
Ndrg2 G T 14: 52,143,674 (GRCm39) R333S probably damaging Het
Nf2 A G 11: 4,732,194 (GRCm39) I507T possibly damaging Het
Nktr A G 9: 121,578,356 (GRCm39) probably benign Het
Nkx3-1 G A 14: 69,428,455 (GRCm39) probably benign Het
Npat T C 9: 53,467,781 (GRCm39) probably null Het
Nrxn1 T C 17: 90,872,801 (GRCm39) N1047S probably damaging Het
Nup210 A T 6: 91,003,911 (GRCm39) I1402N possibly damaging Het
Or5d40 G T 2: 88,015,624 (GRCm39) M134I possibly damaging Het
Parp14 G A 16: 35,677,130 (GRCm39) A946V probably benign Het
Pdcl2 C T 5: 76,460,328 (GRCm39) S182N probably benign Het
Pdia3 G A 2: 121,262,858 (GRCm39) G275S probably damaging Het
Pla2g4a A G 1: 149,716,455 (GRCm39) F669L probably benign Het
Plekha8 A G 6: 54,606,805 (GRCm39) K367E probably damaging Het
Pola1 A G X: 92,531,693 (GRCm39) probably benign Het
Ppm1d C T 11: 85,236,703 (GRCm39) T494I probably benign Het
Pramel16 T A 4: 143,676,453 (GRCm39) Y217F probably benign Het
Prl6a1 A T 13: 27,498,177 (GRCm39) probably benign Het
Ptprg T A 14: 12,154,131 (GRCm38) S617R probably benign Het
R3hdm2 G A 10: 127,280,313 (GRCm39) G45D probably damaging Het
Rev1 T A 1: 38,098,204 (GRCm39) R780W probably null Het
Rnf139 T A 15: 58,771,676 (GRCm39) F567Y probably damaging Het
Scarf1 T C 11: 75,405,174 (GRCm39) V71A probably damaging Het
Shtn1 A G 19: 58,988,372 (GRCm39) S438P probably damaging Het
Slc30a3 T A 5: 31,246,067 (GRCm39) H221L probably benign Het
Smo A C 6: 29,753,603 (GRCm39) I160L possibly damaging Het
Snapc5 A T 9: 64,086,582 (GRCm39) probably benign Het
Snf8 G T 11: 95,925,799 (GRCm39) probably benign Het
Spata31d1a T C 13: 59,850,245 (GRCm39) S628G probably benign Het
Sphkap A T 1: 83,258,145 (GRCm39) D199E probably damaging Het
Spring1 T C 5: 118,397,154 (GRCm39) Y128H probably damaging Het
Thada C A 17: 84,723,731 (GRCm39) V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 (GRCm39) Q735R probably benign Het
Trim24 G A 6: 37,848,169 (GRCm39) E42K probably benign Het
Trnt1 T A 6: 106,754,869 (GRCm39) probably benign Het
Ttbk2 A T 2: 120,604,353 (GRCm39) M215K probably damaging Het
Ttc8 C T 12: 98,909,718 (GRCm39) probably benign Het
Ube3c A G 5: 29,795,926 (GRCm39) Y105C probably damaging Het
Unc13c A G 9: 73,438,265 (GRCm39) probably benign Het
Usp36 A G 11: 118,153,854 (GRCm39) probably benign Het
Vcf2 C T X: 149,181,360 (GRCm39) A144T probably benign Het
Vmn2r102 T C 17: 19,899,106 (GRCm39) S483P possibly damaging Het
Wdr95 A G 5: 149,511,595 (GRCm39) T432A probably damaging Het
Wnk1 G T 6: 119,903,644 (GRCm39) P2523H probably damaging Het
Xpo4 A G 14: 57,875,665 (GRCm39) probably benign Het
Zar1 G T 5: 72,737,886 (GRCm39) P71Q probably damaging Het
Zbtb41 T C 1: 139,351,348 (GRCm39) Y154H probably benign Het
Zer1 G T 2: 29,994,809 (GRCm39) probably benign Het
Zfp454 A G 11: 50,765,012 (GRCm39) F140S probably benign Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37,028,462 (GRCm39) missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37,024,940 (GRCm39) missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37,036,341 (GRCm39) missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37,165,454 (GRCm39) missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37,020,954 (GRCm39) missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37,150,257 (GRCm39) missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37,028,567 (GRCm39) missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37,007,016 (GRCm39) nonsense probably null
IGL03125:Stxbp5l APN 16 37,007,083 (GRCm39) missense probably benign 0.02
R0058:Stxbp5l UTSW 16 36,962,736 (GRCm39) missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37,108,670 (GRCm39) missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37,036,440 (GRCm39) splice site probably benign
R0454:Stxbp5l UTSW 16 36,954,646 (GRCm39) missense possibly damaging 0.94
R0525:Stxbp5l UTSW 16 36,950,159 (GRCm39) critical splice donor site probably null
R0543:Stxbp5l UTSW 16 37,028,458 (GRCm39) missense probably damaging 1.00
R0607:Stxbp5l UTSW 16 36,962,794 (GRCm39) missense probably benign 0.00
R1333:Stxbp5l UTSW 16 37,068,231 (GRCm39) critical splice donor site probably null
R1593:Stxbp5l UTSW 16 36,936,414 (GRCm39) missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37,028,473 (GRCm39) missense probably benign 0.34
R1670:Stxbp5l UTSW 16 37,111,289 (GRCm39) critical splice donor site probably null
R2077:Stxbp5l UTSW 16 37,056,637 (GRCm39) missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37,036,398 (GRCm39) missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 36,936,029 (GRCm39) missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37,028,548 (GRCm39) missense possibly damaging 0.89
R2917:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2918:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2935:Stxbp5l UTSW 16 36,954,551 (GRCm39) missense possibly damaging 0.76
R3693:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3694:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3695:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R4133:Stxbp5l UTSW 16 37,028,481 (GRCm39) missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37,068,242 (GRCm39) missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37,076,246 (GRCm39) missense probably damaging 1.00
R4757:Stxbp5l UTSW 16 37,008,996 (GRCm39) missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 36,954,592 (GRCm39) missense probably benign 0.18
R5105:Stxbp5l UTSW 16 36,962,734 (GRCm39) missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37,007,016 (GRCm39) missense probably benign 0.19
R5358:Stxbp5l UTSW 16 36,994,688 (GRCm39) missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 36,950,213 (GRCm39) missense probably damaging 1.00
R5773:Stxbp5l UTSW 16 37,028,459 (GRCm39) missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 36,950,177 (GRCm39) missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37,024,810 (GRCm39) missense possibly damaging 0.74
R6892:Stxbp5l UTSW 16 37,008,991 (GRCm39) missense possibly damaging 0.94
R7369:Stxbp5l UTSW 16 36,954,703 (GRCm39) missense probably benign 0.12
R7555:Stxbp5l UTSW 16 37,143,965 (GRCm39) missense probably damaging 1.00
R7657:Stxbp5l UTSW 16 37,030,534 (GRCm39) missense probably null 0.21
R8171:Stxbp5l UTSW 16 37,028,416 (GRCm39) missense noncoding transcript
R8338:Stxbp5l UTSW 16 36,994,718 (GRCm39) missense probably damaging 1.00
R8732:Stxbp5l UTSW 16 37,061,809 (GRCm39) missense probably benign
R8833:Stxbp5l UTSW 16 37,024,814 (GRCm39) missense probably benign 0.44
R8883:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8898:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8899:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8906:Stxbp5l UTSW 16 37,028,526 (GRCm39) missense probably damaging 1.00
R8918:Stxbp5l UTSW 16 36,954,892 (GRCm39) missense
R8959:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8961:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8989:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R9027:Stxbp5l UTSW 16 37,165,473 (GRCm39) missense probably damaging 1.00
R9044:Stxbp5l UTSW 16 37,024,930 (GRCm39) missense possibly damaging 0.77
R9226:Stxbp5l UTSW 16 37,076,206 (GRCm39) missense probably damaging 0.96
R9284:Stxbp5l UTSW 16 37,028,442 (GRCm39) nonsense probably null
R9351:Stxbp5l UTSW 16 36,936,047 (GRCm39) missense probably damaging 1.00
R9425:Stxbp5l UTSW 16 36,994,706 (GRCm39) missense possibly damaging 0.83
R9545:Stxbp5l UTSW 16 37,028,625 (GRCm39) critical splice acceptor site probably null
R9567:Stxbp5l UTSW 16 37,061,734 (GRCm39) missense probably benign 0.37
R9616:Stxbp5l UTSW 16 37,036,314 (GRCm39) missense probably damaging 1.00
R9781:Stxbp5l UTSW 16 37,165,485 (GRCm39) missense probably benign 0.38
Z1088:Stxbp5l UTSW 16 37,024,851 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGGAGGTTATTCAAAGACAATCATGCT -3'
(R):5'- TTTCTGCCACACAAATGCAATATGAAGG -3'

Sequencing Primer
(F):5'- GAGAGAGCAATAACTTTAACCGTTAC -3'
(R):5'- gtgagcaggacacccag -3'
Posted On 2013-07-11