Incidental Mutation 'R0606:Hnrnpm'
ID54188
Institutional Source Beutler Lab
Gene Symbol Hnrnpm
Ensembl Gene ENSMUSG00000059208
Gene Nameheterogeneous nuclear ribonucleoprotein M
SynonymsHnrpm, 2610023M21Rik
MMRRC Submission 038795-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R0606 (G1)
Quality Score124
Status Validated
Chromosome17
Chromosomal Location33646233-33686860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33658390 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 53 (N53I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087582] [ENSMUST00000114385] [ENSMUST00000139302] [ENSMUST00000148178]
Predicted Effect probably benign
Transcript: ENSMUST00000087582
AA Change: N333I

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084864
Gene: ENSMUSG00000059208
AA Change: N333I

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.7e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 2e-50 BLAST
low complexity region 590 603 N/A INTRINSIC
RRM 614 685 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114385
AA Change: N372I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110027
Gene: ENSMUSG00000059208
AA Change: N372I

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.5e-20 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 3.9e-5 PROSPERO
internal_repeat_2 479 581 3.9e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
internal_repeat_1 643 676 1.39e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000130946
AA Change: N53I

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116671
Gene: ENSMUSG00000059208
AA Change: N53I

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139302
AA Change: N333I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115787
Gene: ENSMUSG00000059208
AA Change: N333I

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.4e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 8e-51 BLAST
low complexity region 590 603 N/A INTRINSIC
internal_repeat_1 611 635 5.49e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000148178
AA Change: N372I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000120115
Gene: ENSMUSG00000059208
AA Change: N372I

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.2e-22 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 6.64e-5 PROSPERO
internal_repeat_2 479 581 6.64e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
RRM 653 724 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148258
AA Change: N178I

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123580
Gene: ENSMUSG00000059208
AA Change: N178I

DomainStartEndE-ValueType
RRM 21 93 1.66e-20 SMART
low complexity region 113 130 N/A INTRINSIC
low complexity region 146 167 N/A INTRINSIC
low complexity region 196 202 N/A INTRINSIC
internal_repeat_1 206 227 9.85e-5 PROSPERO
internal_repeat_1 221 238 9.85e-5 PROSPERO
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNAs. This protein also constitutes a monomer of the N-acetylglucosamine-specific receptor which is postulated to trigger selective recycling of immature GlcNAc-bearing thyroglobulin molecules. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,259,089 Y128H probably damaging Het
Actl9 T C 17: 33,433,598 Y211H probably damaging Het
Actn1 A T 12: 80,174,647 probably benign Het
Adtrp A G 13: 41,767,405 F197L probably damaging Het
Ankrd11 G A 8: 122,892,832 T1406I probably benign Het
Arhgap24 A T 5: 102,897,220 R620W probably damaging Het
Atg13 A G 2: 91,682,073 Y284H probably benign Het
Atrn A G 2: 130,906,856 E99G possibly damaging Het
Cage1 A T 13: 38,016,494 probably benign Het
Ccr3 T A 9: 124,028,802 M58K probably benign Het
Cdk18 G T 1: 132,117,617 probably benign Het
Chst5 A G 8: 111,890,919 V23A probably benign Het
Col4a3 T C 1: 82,672,586 probably benign Het
Col4a6 A G X: 141,192,223 probably benign Het
Csmd3 T C 15: 48,457,662 I251V probably benign Het
Csnk1g3 G A 18: 53,917,028 V115M probably damaging Het
Cst7 A T 2: 150,570,519 M1L probably benign Het
Cyp4f17 A T 17: 32,527,843 D373V probably damaging Het
Dclk2 G A 3: 86,906,004 R212W probably damaging Het
Dhrs7b T G 11: 60,830,746 probably benign Het
Dhx58 T A 11: 100,702,251 H210L probably benign Het
Dnah9 T C 11: 65,841,333 Y4249C probably damaging Het
Eif5b T A 1: 38,048,893 L990H probably damaging Het
Faap24 T C 7: 35,394,963 probably benign Het
Fryl T A 5: 73,124,734 H174L probably benign Het
Gabrr1 T C 4: 33,132,696 W15R probably benign Het
Gif A T 19: 11,752,294 I206F possibly damaging Het
Gm15446 T C 5: 109,943,481 V533A probably benign Het
Gm6760 T A X: 64,151,653 K63* probably null Het
Gne C T 4: 44,042,244 E444K possibly damaging Het
Gpr173 T A X: 152,347,040 M146L possibly damaging Het
Hira C T 16: 18,935,047 S547L probably benign Het
Hnf1b A G 11: 83,863,984 H161R probably benign Het
Hs3st5 A T 10: 36,832,588 I40F probably benign Het
Hydin C T 8: 110,549,798 probably benign Het
Ift172 A G 5: 31,254,313 I1607T probably damaging Het
Igfn1 T C 1: 135,959,901 Q2475R probably damaging Het
Il6st T C 13: 112,504,272 S800P possibly damaging Het
Iqub G A 6: 24,501,261 probably benign Het
Itgb1 A T 8: 128,722,372 probably benign Het
Kctd21 G A 7: 97,347,601 E94K probably benign Het
Kir3dl2 A G X: 136,453,511 V233A possibly damaging Het
Klra2 A T 6: 131,220,224 C271S probably damaging Het
Lacc1 A T 14: 77,029,621 C401S probably damaging Het
Lmna T C 3: 88,482,578 E580G probably damaging Het
Matn2 A G 15: 34,345,150 Y101C probably damaging Het
Mrps16 G A 14: 20,391,389 R116* probably null Het
Ndrg2 G T 14: 51,906,217 R333S probably damaging Het
Nf2 A G 11: 4,782,194 I507T possibly damaging Het
Nktr A G 9: 121,749,290 probably benign Het
Nkx3-1 G A 14: 69,191,006 probably benign Het
Npat T C 9: 53,556,481 probably null Het
Nrxn1 T C 17: 90,565,373 N1047S probably damaging Het
Nup210 A T 6: 91,026,929 I1402N possibly damaging Het
Olfr1168 G T 2: 88,185,280 M134I possibly damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdcl2 C T 5: 76,312,481 S182N probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pla2g4a A G 1: 149,840,704 F669L probably benign Het
Plekha8 A G 6: 54,629,820 K367E probably damaging Het
Pola1 A G X: 93,488,087 probably benign Het
Ppm1d C T 11: 85,345,877 T494I probably benign Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prl6a1 A T 13: 27,314,194 probably benign Het
Ptprg T A 14: 12,154,131 S617R probably benign Het
R3hdm2 G A 10: 127,444,444 G45D probably damaging Het
Rev1 T A 1: 38,059,123 R780W probably null Het
Rnf139 T A 15: 58,899,827 F567Y probably damaging Het
Scarf1 T C 11: 75,514,348 V71A probably damaging Het
Shtn1 A G 19: 58,999,940 S438P probably damaging Het
Slc30a3 T A 5: 31,088,723 H221L probably benign Het
Smo A C 6: 29,753,604 I160L possibly damaging Het
Snapc5 A T 9: 64,179,300 probably benign Het
Snf8 G T 11: 96,034,973 probably benign Het
Spata31d1a T C 13: 59,702,431 S628G probably benign Het
Sphkap A T 1: 83,280,424 D199E probably damaging Het
Stxbp5l T C 16: 37,204,521 T572A possibly damaging Het
Thada C A 17: 84,416,303 V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 Q735R probably benign Het
Tmem29 C T X: 150,398,364 A144T probably benign Het
Trim24 G A 6: 37,871,234 E42K probably benign Het
Trnt1 T A 6: 106,777,908 probably benign Het
Ttbk2 A T 2: 120,773,872 M215K probably damaging Het
Ttc8 C T 12: 98,943,459 probably benign Het
Ube3c A G 5: 29,590,928 Y105C probably damaging Het
Unc13c A G 9: 73,530,983 probably benign Het
Usp36 A G 11: 118,263,028 probably benign Het
Vmn2r102 T C 17: 19,678,844 S483P possibly damaging Het
Wdr95 A G 5: 149,588,130 T432A probably damaging Het
Wnk1 G T 6: 119,926,683 P2523H probably damaging Het
Xpo4 A G 14: 57,638,208 probably benign Het
Zar1 G T 5: 72,580,543 P71Q probably damaging Het
Zbtb41 T C 1: 139,423,610 Y154H probably benign Het
Zer1 G T 2: 30,104,797 probably benign Het
Zfp454 A G 11: 50,874,185 F140S probably benign Het
Other mutations in Hnrnpm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00869:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00870:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00886:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00898:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00900:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00901:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00905:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00907:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00908:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00911:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00912:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00920:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00921:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00922:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00923:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00924:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00926:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00927:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00928:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00929:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00930:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00931:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00932:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00935:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00938:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00945:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00950:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00952:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00953:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00954:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00955:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00956:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00957:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00958:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00959:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00960:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL01301:Hnrnpm APN 17 33669168 critical splice donor site probably null
IGL02152:Hnrnpm APN 17 33658412 missense probably damaging 1.00
IGL02319:Hnrnpm APN 17 33649950 missense probably damaging 0.98
IGL02487:Hnrnpm APN 17 33648813 missense probably damaging 1.00
IGL03099:Hnrnpm APN 17 33669172 missense probably damaging 1.00
ANU18:Hnrnpm UTSW 17 33669168 critical splice donor site probably null
E0370:Hnrnpm UTSW 17 33658922 splice site probably benign
R0153:Hnrnpm UTSW 17 33646515 missense probably damaging 0.99
R0254:Hnrnpm UTSW 17 33652268 splice site probably null
R0940:Hnrnpm UTSW 17 33650002 missense probably damaging 1.00
R1216:Hnrnpm UTSW 17 33649713 missense probably damaging 0.99
R1392:Hnrnpm UTSW 17 33658415 missense possibly damaging 0.62
R1392:Hnrnpm UTSW 17 33658415 missense possibly damaging 0.62
R1454:Hnrnpm UTSW 17 33666488 splice site probably benign
R2011:Hnrnpm UTSW 17 33664624 missense probably damaging 1.00
R4678:Hnrnpm UTSW 17 33650211 missense possibly damaging 0.54
R4926:Hnrnpm UTSW 17 33649801 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGAAGCAGGCTGGGCTAGGATT -3'
(R):5'- GGCCATCCCACCTTTGAAATGTAGTAA -3'

Sequencing Primer
(F):5'- ccataggacaaccggcag -3'
(R):5'- ctctctaactagctctgtgacc -3'
Posted On2013-07-11