Incidental Mutation 'R6965:Iqcg'
ID541969
Institutional Source Beutler Lab
Gene Symbol Iqcg
Ensembl Gene ENSMUSG00000035578
Gene NameIQ motif containing G
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6965 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location33012683-33056218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33030804 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 266 (A266T)
Ref Sequence ENSEMBL: ENSMUSP00000110752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115100]
Predicted Effect probably benign
Transcript: ENSMUST00000115100
AA Change: A266T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110752
Gene: ENSMUSG00000035578
AA Change: A266T

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
coiled coil region 248 329 N/A INTRINSIC
IQ 371 393 1.54e-2 SMART
low complexity region 399 419 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous male mice are infertile and have very low epididymal sperm concentration with low motility, predominantly appearing as sperm heads without tails or with short tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,283,229 Q1205* probably null Het
Als2 A G 1: 59,170,557 F1422S possibly damaging Het
Anapc4 T C 5: 52,835,751 V68A possibly damaging Het
Atmin T C 8: 116,957,038 F479S probably damaging Het
Atp7b T C 8: 22,028,085 T234A probably benign Het
Bpifa1 G A 2: 154,145,661 G144S probably damaging Het
Brf2 A T 8: 27,124,558 M200K probably benign Het
C1ql2 G A 1: 120,341,215 C33Y probably damaging Het
Cdk18 A G 1: 132,117,581 V269A probably damaging Het
Clcc1 T C 3: 108,673,309 V313A probably damaging Het
Cntrl A T 2: 35,162,833 T1117S probably benign Het
Col15a1 G A 4: 47,247,533 E236K probably damaging Het
Comp T C 8: 70,376,514 L278P probably damaging Het
Dlg5 C A 14: 24,149,430 D1469Y probably damaging Het
Efna1 A T 3: 89,279,475 V23D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epb41l4b T C 4: 57,040,915 Y516C probably damaging Het
Esr2 T C 12: 76,121,857 D526G probably damaging Het
Fam184b T C 5: 45,555,135 T514A probably benign Het
Fcmr A C 1: 130,875,987 E176A possibly damaging Het
Fry T A 5: 150,416,220 N1485K possibly damaging Het
Fut2 A G 7: 45,650,881 C156R probably damaging Het
Gm10031 C T 1: 156,524,549 R107* probably null Het
Gm5431 T C 11: 48,895,200 Y116C probably benign Het
Gm5493 T A 17: 22,748,074 V61E possibly damaging Het
Golga4 A T 9: 118,548,779 Q456L probably damaging Het
Gpam T C 19: 55,074,609 Y757C probably damaging Het
Lta4h G T 10: 93,471,897 G331* probably null Het
Macf1 C A 4: 123,408,745 V655F probably benign Het
Map3k13 T A 16: 21,922,150 D742E probably benign Het
Mrgprb2 G A 7: 48,552,849 L43F probably damaging Het
N4bp1 T C 8: 86,844,833 R846G probably damaging Het
Nbn T C 4: 15,970,863 I282T probably benign Het
Ncor1 C T 11: 62,353,233 probably null Het
Olfr1250 G T 2: 89,656,665 P259T probably damaging Het
Olfr1426 A G 19: 12,088,756 F12S possibly damaging Het
Olfr874 T A 9: 37,746,137 M1K probably null Het
Pclo A G 5: 14,681,962 probably benign Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Ptch1 T C 13: 63,525,067 Y771C possibly damaging Het
R3hcc1l G A 19: 42,562,845 D94N probably damaging Het
Rnpep T A 1: 135,263,120 K602* probably null Het
Rph3al T C 11: 75,854,450 Y156C probably damaging Het
Rundc1 A T 11: 101,433,911 Y481F possibly damaging Het
Serpinb9f A G 13: 33,325,876 K17R possibly damaging Het
Smpd3 T C 8: 106,259,881 H459R probably damaging Het
Spata31 A C 13: 64,922,834 Q932P possibly damaging Het
Srgap3 C T 6: 112,723,129 A963T probably damaging Het
Syne1 A T 10: 5,229,120 F4451L possibly damaging Het
Tbc1d19 T A 5: 53,856,924 probably null Het
Thap12 T A 7: 98,715,462 V279D probably damaging Het
Tmprss6 T C 15: 78,444,128 D544G probably damaging Het
Tox2 A G 2: 163,323,010 *523W probably null Het
Txnrd1 T C 10: 82,881,818 I212T probably benign Het
Unc80 T C 1: 66,646,566 I2283T probably benign Het
Vmn1r176 A G 7: 23,835,674 I18T possibly damaging Het
Vmn2r101 C T 17: 19,591,022 T456I probably benign Het
Vmn2r79 T A 7: 87,001,892 H166Q probably benign Het
Zer1 A G 2: 30,101,047 V723A possibly damaging Het
Other mutations in Iqcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Iqcg APN 16 33035600 missense possibly damaging 0.90
IGL01155:Iqcg APN 16 33040875 missense probably damaging 0.99
IGL01602:Iqcg APN 16 33016978 unclassified probably benign
IGL01605:Iqcg APN 16 33016978 unclassified probably benign
IGL02243:Iqcg APN 16 33045592 missense probably damaging 1.00
IGL02328:Iqcg APN 16 33019506 missense probably benign 0.00
IGL02490:Iqcg APN 16 33035567 nonsense probably null
IGL03297:Iqcg APN 16 33035632 splice site probably benign
R0038:Iqcg UTSW 16 33045642 missense probably benign 0.03
R0453:Iqcg UTSW 16 33049843 splice site probably benign
R0719:Iqcg UTSW 16 33040845 missense probably benign 0.26
R1191:Iqcg UTSW 16 33049943 missense probably benign 0.43
R1544:Iqcg UTSW 16 33045525 missense probably benign 0.01
R2292:Iqcg UTSW 16 33049883 missense probably benign 0.25
R3725:Iqcg UTSW 16 33020539 unclassified probably null
R3726:Iqcg UTSW 16 33029041 missense probably damaging 1.00
R3732:Iqcg UTSW 16 33053626 unclassified probably benign
R3732:Iqcg UTSW 16 33053626 unclassified probably benign
R3733:Iqcg UTSW 16 33053626 unclassified probably benign
R3734:Iqcg UTSW 16 33053626 unclassified probably benign
R3770:Iqcg UTSW 16 33050008 synonymous silent
R4296:Iqcg UTSW 16 33016975 unclassified probably benign
R4409:Iqcg UTSW 16 33045518 critical splice donor site probably null
R4410:Iqcg UTSW 16 33030816 missense possibly damaging 0.95
R4429:Iqcg UTSW 16 33019490 missense probably benign 0.02
R4603:Iqcg UTSW 16 33040764 missense probably null 0.68
R4603:Iqcg UTSW 16 33040763 critical splice donor site probably null
R4979:Iqcg UTSW 16 33019514 missense probably damaging 1.00
R5672:Iqcg UTSW 16 33019508 missense probably damaging 0.99
R6183:Iqcg UTSW 16 33030923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCAAATCATCTATCTACCCGAG -3'
(R):5'- TGATGGCTAATCCTAACACAGC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- AGGTACGCCTTCAGGAATTC -3'
Posted On2018-11-28