Incidental Mutation 'R6966:Hs6st1'
ID541977
Institutional Source Beutler Lab
Gene Symbol Hs6st1
Ensembl Gene ENSMUSG00000045216
Gene Nameheparan sulfate 6-O-sulfotransferase 1
Synonyms6OST1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R6966 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location36068400-36106446 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 36104218 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 411 (W411*)
Ref Sequence ENSEMBL: ENSMUSP00000085499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088174]
Predicted Effect probably null
Transcript: ENSMUST00000088174
AA Change: W411*
SMART Domains Protein: ENSMUSP00000085499
Gene: ENSMUSG00000045216
AA Change: W411*

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
Pfam:Sulfotransfer_2 79 351 2e-79 PFAM
coiled coil region 352 386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biological activities. This enzyme is a type II integral membrane protein and is responsible for 6-O-sulfation of heparan sulfate. This enzyme does not share significant sequence similarity with other known sulfotransferases. A pseudogene located on chromosome 1 has been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show prenatal loss, stunted growth, dilated alveoli and lower postweaning survival. Homozygotes for another null allele show additional defects in placenta, eye, phalanx and tarsus morphology. Homozygotes for a gene trapallele show altered retinal axon guidance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,521,435 R177C possibly damaging Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Bahcc1 G A 11: 120,283,159 V1582M probably damaging Het
Baiap2 A T 11: 120,006,405 R529* probably null Het
Bcl9l C T 9: 44,509,388 Q1327* probably null Het
Brsk2 T A 7: 141,984,533 C139S possibly damaging Het
Catsper3 T A 13: 55,798,859 I123N probably damaging Het
Cd84 A G 1: 171,886,409 N325D possibly damaging Het
Chid1 T A 7: 141,496,384 Y357F possibly damaging Het
Clstn2 A T 9: 97,526,406 Y416* probably null Het
Cnot1 A T 8: 95,724,532 L2189Q probably damaging Het
Csnk2b T A 17: 35,117,782 I170L probably benign Het
Dnah3 T C 7: 120,032,754 Q1326R probably damaging Het
Drd1 T C 13: 54,053,545 I210V probably damaging Het
Eef1d G T 15: 75,903,709 Q34K probably benign Het
Fam184a T C 10: 53,654,999 T760A probably benign Het
Fnip1 G T 11: 54,482,559 V199F probably benign Het
Glyatl3 T C 17: 40,904,938 K226E probably damaging Het
Gm19410 C T 8: 35,817,973 T2093I possibly damaging Het
Herc1 A T 9: 66,411,065 E1206D probably benign Het
Hsf2 C A 10: 57,495,984 S60R probably damaging Het
Hyal5 C A 6: 24,891,292 N368K probably damaging Het
Itgb2l A T 16: 96,430,643 F308I probably benign Het
Kdm7a G A 6: 39,152,839 L468F probably damaging Het
Lamp3 A T 16: 19,699,653 L278* probably null Het
Ly6c1 A T 15: 75,045,440 probably benign Het
Mark3 A G 12: 111,640,024 N524D probably damaging Het
Met T G 6: 17,531,532 L603R possibly damaging Het
Mical1 A T 10: 41,479,754 Q198L probably damaging Het
Nacad T A 11: 6,602,634 I186F possibly damaging Het
Nt5c3b A T 11: 100,429,924 M257K probably benign Het
Nuak2 T C 1: 132,325,032 M108T possibly damaging Het
Nub1 T A 5: 24,689,472 Y51N probably damaging Het
Nxpe5 T C 5: 138,239,417 S68P probably damaging Het
Olfr1124 C T 2: 87,435,279 T264I probably damaging Het
Olfr1174-ps A G 2: 88,311,491 S102P probably benign Het
Olfr798 A G 10: 129,625,764 V99A probably benign Het
Pias3 A G 3: 96,702,195 D276G probably damaging Het
Setd7 A G 3: 51,530,184 Y217H probably damaging Het
Slc23a1 A T 18: 35,625,061 I142N probably damaging Het
Slx4ip T C 2: 137,068,224 S310P probably damaging Het
Tcp11l2 G A 10: 84,591,269 R199Q possibly damaging Het
Tgm4 T A 9: 123,051,142 D226E possibly damaging Het
Tspyl4 C A 10: 34,297,677 A55E probably benign Het
Uap1l1 A G 2: 25,364,938 I146T probably damaging Het
Ush2a G A 1: 188,576,244 G2030D probably damaging Het
Uts2r G A 11: 121,161,387 G359D possibly damaging Het
Vwa7 T C 17: 35,017,096 S9P probably benign Het
Zbtb16 A G 9: 48,657,354 C604R probably damaging Het
Zfp804b A G 5: 6,771,615 S483P probably damaging Het
Zfpm1 G A 8: 122,332,165 A175T probably damaging Het
Other mutations in Hs6st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Hs6st1 APN 1 36103704 missense probably damaging 0.98
IGL01721:Hs6st1 APN 1 36068935 missense probably damaging 1.00
IGL02123:Hs6st1 APN 1 36103871 missense possibly damaging 0.84
IGL02498:Hs6st1 APN 1 36103740 missense probably damaging 1.00
IGL02662:Hs6st1 APN 1 36103812 nonsense probably null
IGL02730:Hs6st1 APN 1 36103628 missense probably damaging 1.00
R0359:Hs6st1 UTSW 1 36069185 critical splice donor site probably null
R0360:Hs6st1 UTSW 1 36069185 critical splice donor site probably null
R1268:Hs6st1 UTSW 1 36068926 missense probably damaging 1.00
R1355:Hs6st1 UTSW 1 36103576 missense probably damaging 1.00
R1521:Hs6st1 UTSW 1 36068886 missense probably damaging 0.99
R1942:Hs6st1 UTSW 1 36068722 missense probably benign
R2364:Hs6st1 UTSW 1 36068719 missense probably benign 0.05
R4418:Hs6st1 UTSW 1 36104027 missense probably damaging 1.00
R4570:Hs6st1 UTSW 1 36103547 missense possibly damaging 0.84
R5319:Hs6st1 UTSW 1 36104178 missense probably benign 0.01
R5370:Hs6st1 UTSW 1 36069081 missense probably damaging 0.99
R5567:Hs6st1 UTSW 1 36103638 missense probably benign 0.06
R5570:Hs6st1 UTSW 1 36103638 missense probably benign 0.06
R5668:Hs6st1 UTSW 1 36103889 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCAGCAGCGTTACCAGTAC -3'
(R):5'- TCGGCTAAGCAGACACGTTC -3'

Sequencing Primer
(F):5'- CGTTACCAGTACAAGAGACAGCTG -3'
(R):5'- CAGTTTTAACTATGACATGGGGGCC -3'
Posted On2018-11-28